ID: 989368849

View in Genome Browser
Species Human (GRCh38)
Location 5:40683758-40683780
Sequence GTGTAAGGGCCCTGAATCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989368849_989368852 -1 Left 989368849 5:40683758-40683780 CCTAAGATTCAGGGCCCTTACAC 0: 1
1: 0
2: 1
3: 3
4: 83
Right 989368852 5:40683780-40683802 CAAAGCCTTGAAATTATTTGAGG 0: 1
1: 0
2: 4
3: 28
4: 302
989368849_989368855 22 Left 989368849 5:40683758-40683780 CCTAAGATTCAGGGCCCTTACAC 0: 1
1: 0
2: 1
3: 3
4: 83
Right 989368855 5:40683803-40683825 ACCTAGAGGCAAGAAATTATAGG 0: 1
1: 0
2: 0
3: 15
4: 200
989368849_989368854 8 Left 989368849 5:40683758-40683780 CCTAAGATTCAGGGCCCTTACAC 0: 1
1: 0
2: 1
3: 3
4: 83
Right 989368854 5:40683789-40683811 GAAATTATTTGAGGACCTAGAGG 0: 1
1: 0
2: 1
3: 7
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989368849 Original CRISPR GTGTAAGGGCCCTGAATCTT AGG (reversed) Intronic
905582810 1:39095038-39095060 CTGGAAGCTCCCTGAATCTTAGG + Intronic
907272914 1:53301150-53301172 GTGGAAGGGCCCTGAAGCCAGGG + Intronic
908575801 1:65458701-65458723 GTGTGAGCTTCCTGAATCTTTGG + Intronic
920502993 1:206497122-206497144 GTGTGAGGGGCCTGGAACTTAGG + Intronic
923469667 1:234279365-234279387 GTGAAAGGGCAATAAATCTTGGG - Intronic
1063022905 10:2147178-2147200 GTGGAAGGTCACTGAATCATGGG + Intergenic
1063061763 10:2563103-2563125 GTTTAAGACCACTGAATCTTGGG - Intergenic
1063772872 10:9224221-9224243 GTGCATGGGCCCTGATTCTAGGG - Intergenic
1068260777 10:54578233-54578255 GTTTGAGGGCCCCTAATCTTGGG + Intronic
1069705527 10:70456924-70456946 CTGTACAGGCCCTGAATGTTAGG - Intergenic
1074640824 10:115378361-115378383 CTGAAATGGCCCTGGATCTTGGG - Intronic
1074859997 10:117502868-117502890 ATGCAAGGGCCCTGCTTCTTTGG - Intergenic
1076927485 10:133499659-133499681 GTAGAAGGTCCCTGAATTTTAGG + Intergenic
1080065245 11:28003062-28003084 GTGTAAGGTAATTGAATCTTGGG + Intergenic
1080948242 11:36998905-36998927 GCCTAAGGGCCCTGGATCCTGGG - Intergenic
1085171861 11:74456496-74456518 GAGTCAGGACCCTGAATGTTAGG - Exonic
1085651243 11:78270508-78270530 GTGGAAGGGCCCAGAATCCAAGG - Intronic
1088765936 11:112978044-112978066 GTGTAAGGATCCTGAACGTTGGG + Intronic
1090567798 11:128014835-128014857 GTGTCAGGGCCCTGATTACTGGG - Intergenic
1091190215 11:133687408-133687430 GTGTAAGAGCCCTGAACTATAGG + Intergenic
1091889670 12:4043525-4043547 GGTTAGGGGCCATGAATCTTAGG + Intergenic
1094766303 12:33598783-33598805 GAGAAAGGCACCTGAATCTTTGG - Intergenic
1103700064 12:122844627-122844649 GTGTGAGGCCCCTGCCTCTTGGG + Intronic
1117529683 14:56647836-56647858 GTGTAAGGGCCATGCTTATTGGG + Exonic
1129999337 15:80033694-80033716 GTGTGAGTGGCCTGCATCTTAGG - Intergenic
1134125951 16:11616109-11616131 CTGGAAGGGCCCTGAATGTAGGG - Intronic
1141622817 16:85246182-85246204 GTGTAGGGTCCCTGAAGCTGGGG - Intergenic
1151980344 17:77504693-77504715 TTGTAAGGTGCCTAAATCTTCGG + Intergenic
1152104972 17:78323488-78323510 GTGGCAGGGCCCTGCTTCTTCGG - Intergenic
1158163247 18:54509295-54509317 GTATTAGGGTCCTGACTCTTGGG + Intergenic
1158819025 18:61136791-61136813 TTTTCAAGGCCCTGAATCTTAGG + Intergenic
1160668702 19:345560-345582 GGATAAGTGCCGTGAATCTTCGG + Intergenic
1161129607 19:2580121-2580143 GTGTATGGGCCCTGACCCCTGGG - Intronic
1162553341 19:11370912-11370934 GTGCAAGGGCCCTGAGGCATTGG - Intergenic
1162578690 19:11514354-11514376 TTGTAATGGCCTCGAATCTTGGG - Intronic
1162762096 19:12894653-12894675 GTGACAAGGCGCTGAATCTTGGG - Intronic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
925648225 2:6060281-6060303 GTGCAAGGGCCCTGCAGCTTCGG - Intergenic
928457140 2:31432455-31432477 CTGTAAGGGTCCTGAATCCCTGG - Intergenic
936938819 2:117862021-117862043 GTCTAAGGGCCTTGAATCACAGG + Intergenic
947550688 2:231043327-231043349 TTATAAGGGGCCAGAATCTTGGG + Intronic
948504835 2:238421821-238421843 ATGTATGAGCCCTGAAGCTTCGG + Intergenic
1169106087 20:2995741-2995763 ATGTAAAGGCCCTGAGTCTTGGG + Intronic
1172757359 20:37295586-37295608 GGGTAAGCGCCCTGACTCTGGGG + Intronic
1177095361 21:16825422-16825444 GTGGAGGGCCCCTGCATCTTAGG - Intergenic
1180666169 22:17514344-17514366 GTGTAAGGGCACAGCATGTTGGG + Intronic
1180937749 22:19637244-19637266 GTGGGAGGCCCCTGACTCTTTGG + Intergenic
1181506333 22:23360743-23360765 GTGTAAGGGCCTGGCCTCTTTGG + Intergenic
1184891658 22:47383110-47383132 GTGGAAGGTCACTGAATCATGGG + Intergenic
949163861 3:913576-913598 GTGAAAGGAAACTGAATCTTAGG + Intergenic
952041728 3:29269077-29269099 GTGTGAGGCCCCTGAGACTTTGG - Intergenic
953469885 3:43157540-43157562 GTGTAAAGGCACTGAAATTTGGG + Intergenic
954334681 3:49909377-49909399 GTGTATGGGGCCTCAATCTCAGG + Exonic
954688562 3:52383781-52383803 GTGCAAGGGCCCTGGGTCCTGGG + Intronic
955355447 3:58227509-58227531 CTGTAAGGGACCTGTCTCTTAGG + Intergenic
955625673 3:60916526-60916548 ATGAAATGGCCTTGAATCTTGGG - Intronic
962728726 3:138259760-138259782 GTGTATGGTCCCTGATACTTTGG - Intronic
964124201 3:153218795-153218817 ATGTAAGGTTCCTGAATGTTTGG + Intergenic
964230725 3:154464014-154464036 CAGTAAGTACCCTGAATCTTGGG + Intergenic
964491301 3:157239337-157239359 GTCAACGAGCCCTGAATCTTTGG + Intergenic
966641498 3:182195839-182195861 ATGCAAGGGCCCTGAGTATTTGG + Intergenic
967753927 3:193147392-193147414 TTCTCAGGGCCCTGAATTTTGGG + Intergenic
973189043 4:47366083-47366105 GTATGAGGGCACTGAATGTTGGG - Intronic
976198154 4:82552901-82552923 GTGGAAGGGTGCTGCATCTTAGG + Intronic
987603047 5:20097484-20097506 GTGGAAGGTAACTGAATCTTGGG - Intronic
989368849 5:40683758-40683780 GTGTAAGGGCCCTGAATCTTAGG - Intronic
992531267 5:77653907-77653929 GTGTAAGGGCCTTGAATCATAGG - Intergenic
993669285 5:90740747-90740769 GTGAATGGGCCCAGAATGTTGGG + Intronic
994427023 5:99602897-99602919 TTGTAAGGGACATGAATATTTGG + Intergenic
1007632233 6:43278938-43278960 GAGGAAGAGCCCTGAATCTCAGG - Intronic
1010491124 6:76477319-76477341 ATGTCAGGGTCATGAATCTTGGG + Intergenic
1013212549 6:107999949-107999971 GTGTAAGGGCCATGCATCTGGGG - Intergenic
1014951837 6:127565117-127565139 CTGTAAGGCCTCTCAATCTTAGG + Intronic
1019216343 6:170446456-170446478 GTTTAAGGGCCCTGGAACTAGGG + Intergenic
1029792533 7:102859976-102859998 AATTAAGGGGCCTGAATCTTAGG + Intronic
1033760132 7:144428668-144428690 GTGGAAGGTAACTGAATCTTGGG - Intergenic
1034414301 7:150956655-150956677 GGGTCAGGTCCCTGAATCCTGGG - Intronic
1037468401 8:19183598-19183620 GTTTAAGGGCCCACTATCTTAGG + Intergenic
1037523867 8:19706099-19706121 TTGTAAGGGCCCTGTATGATTGG - Intronic
1046812448 8:118547514-118547536 GTGTAAGGTGCAAGAATCTTTGG - Intronic
1056908452 9:90675400-90675422 GCTTCAGGGCCTTGAATCTTGGG - Intergenic
1057863979 9:98664755-98664777 GTGGTAGGCACCTGAATCTTTGG - Intronic
1058239147 9:102534668-102534690 GGGTAAGAGCCCTGCATATTAGG - Intergenic
1058678485 9:107421651-107421673 GTGCAAAGGCCCGGAATCTAGGG + Intergenic
1059161036 9:112035236-112035258 GTGAAAGGGCACTGTTTCTTTGG - Intergenic
1192823429 X:74668278-74668300 GTGTGAGAGCCCTGAAACATAGG - Intergenic
1197087849 X:122500237-122500259 GTGTAAGTGCCATGACTCTCTGG + Intergenic
1202027760 Y:20542441-20542463 GTGCAAGGGAACTGAGTCTTGGG - Intergenic