ID: 989373597

View in Genome Browser
Species Human (GRCh38)
Location 5:40735633-40735655
Sequence TCAACAATCATCTGTGTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 194}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989373597_989373601 19 Left 989373597 5:40735633-40735655 CCACAAACACAGATGATTGTTGA 0: 1
1: 0
2: 2
3: 9
4: 194
Right 989373601 5:40735675-40735697 GGAGCAAGCAAAGATTAAAAAGG No data
989373597_989373603 30 Left 989373597 5:40735633-40735655 CCACAAACACAGATGATTGTTGA 0: 1
1: 0
2: 2
3: 9
4: 194
Right 989373603 5:40735686-40735708 AGATTAAAAAGGAGAGGACATGG 0: 1
1: 0
2: 6
3: 63
4: 671
989373597_989373599 -7 Left 989373597 5:40735633-40735655 CCACAAACACAGATGATTGTTGA 0: 1
1: 0
2: 2
3: 9
4: 194
Right 989373599 5:40735649-40735671 TTGTTGATCTGGAGAGCAAAAGG No data
989373597_989373602 24 Left 989373597 5:40735633-40735655 CCACAAACACAGATGATTGTTGA 0: 1
1: 0
2: 2
3: 9
4: 194
Right 989373602 5:40735680-40735702 AAGCAAAGATTAAAAAGGAGAGG 0: 1
1: 1
2: 2
3: 69
4: 763
989373597_989373600 -2 Left 989373597 5:40735633-40735655 CCACAAACACAGATGATTGTTGA 0: 1
1: 0
2: 2
3: 9
4: 194
Right 989373600 5:40735654-40735676 GATCTGGAGAGCAAAAGGAAAGG 0: 1
1: 0
2: 2
3: 34
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989373597 Original CRISPR TCAACAATCATCTGTGTTTG TGG (reversed) Intronic
900478448 1:2887029-2887051 TCAATATACATCTTTGTTTGTGG + Intergenic
901972120 1:12916353-12916375 TCAAACTTCATCAGTGTTTGGGG + Intronic
901989317 1:13099952-13099974 TCAAACTTCATCAGTGTTTGGGG - Intergenic
901992496 1:13126812-13126834 TCAAACTTCATCAGTGTTTGGGG + Intergenic
902013058 1:13285409-13285431 TCAAACTTCATCAGTGTTTGGGG - Intergenic
903296649 1:22347946-22347968 TGAATGATCATCTATGTTTGGGG + Intergenic
906156123 1:43615080-43615102 TCCACCCTCAGCTGTGTTTGGGG + Intronic
906346106 1:45015522-45015544 CGATCAATCATCTGTGTTAGTGG - Exonic
908925738 1:69252487-69252509 TCAATAATCATGAGTGGTTGGGG - Intergenic
909404738 1:75275145-75275167 TCAATAATCTTCTGTGACTGAGG - Intronic
911169717 1:94757889-94757911 TCTGAAATCATCTGTGGTTGGGG + Intergenic
911377646 1:97070627-97070649 TCAACCAGCATATGTGGTTGGGG - Intergenic
911658088 1:100467326-100467348 TCAAGAATCTTCTGCTTTTGAGG - Intronic
913175449 1:116268815-116268837 TCTACAATTATCTGAGGTTGGGG - Intergenic
917639831 1:176972662-176972684 TAAACAATAATATGAGTTTGAGG - Intronic
920951400 1:210574745-210574767 TCATCCCTCATCTGGGTTTGTGG - Intronic
920987933 1:210908056-210908078 TCTACCATCATCTGCCTTTGCGG - Intronic
923077755 1:230625023-230625045 TCAACGCTCTTCTGTGGTTGGGG + Intergenic
923939037 1:238798842-238798864 TAAAAAATCATTTGTGTTTCAGG - Intergenic
923978095 1:239287539-239287561 TCAACAATCCTCTGAGTCTCAGG - Intergenic
1063486301 10:6423896-6423918 TCTACAATCCTCTGTCTGTGTGG - Intergenic
1064372562 10:14765593-14765615 TCAAATATCTTCTGTGTTTGTGG + Intronic
1068873922 10:61976819-61976841 TCCAAATTCATTTGTGTTTGTGG + Intronic
1069197238 10:65567936-65567958 ATAACAATCATTTCTGTTTGGGG + Intergenic
1069215721 10:65816735-65816757 TAAATAACCATCTGTGTTTTTGG - Intergenic
1071082969 10:81834700-81834722 TCAAAAAGCATCTTTGTGTGGGG + Intergenic
1071872497 10:89810633-89810655 TCAATAATCAAAAGTGTTTGAGG - Intergenic
1072848613 10:98861278-98861300 CCAACATTCATCTCTCTTTGGGG + Intronic
1077749100 11:4943868-4943890 TCAAAGATCATCTGTATTTTAGG - Intronic
1077797896 11:5510013-5510035 TCAAGAATCTTCTCTGTGTGAGG - Intronic
1080996908 11:37614388-37614410 TTCTCAAGCATCTGTGTTTGAGG - Intergenic
1086219378 11:84423581-84423603 TCAACATTCAACAGTGTATGAGG - Intronic
1086913601 11:92501561-92501583 TCAACAGTCATTTGTGTGTGTGG + Intronic
1088197293 11:107289089-107289111 TCAAGGAGCATCTGTATTTGAGG - Intergenic
1088853924 11:113729232-113729254 TCAACAATCTGCTGTGTTTGTGG + Intergenic
1091073622 11:132592776-132592798 TCATCAATCATTTGTGATTTTGG - Intronic
1091825918 12:3512579-3512601 TCATAAATCATCTGAGATTGGGG - Intronic
1093442897 12:19220235-19220257 TCATCAATCATATGTGTTCATGG + Intronic
1097751595 12:63360357-63360379 TAAACACTCTTCTGTGTTTAGGG + Intergenic
1100100953 12:91105114-91105136 TTAAAAAGCATGTGTGTTTGGGG - Intronic
1100665072 12:96742503-96742525 TCAACATTCATCTGTGGTTGAGG + Exonic
1100998678 12:100331925-100331947 TAATCAATCAGTTGTGTTTGAGG + Intronic
1101087213 12:101248702-101248724 TCAATAATTATCGGTTTTTGGGG - Intergenic
1101809439 12:108094999-108095021 TAAAGAAACATCTCTGTTTGTGG + Intergenic
1102586012 12:113923538-113923560 TCAAAACTCTTCTGTGTGTGTGG + Intronic
1102718321 12:114994293-114994315 TAAACAGTCAGCTGTGTTTAAGG + Intergenic
1104296813 12:127523415-127523437 TCCACAACCGTCTGTGATTGTGG + Intergenic
1104573679 12:129947143-129947165 CCGACAACCATCTGTGTTTCAGG + Intergenic
1106131134 13:26940441-26940463 TCACAAAGCATCTGGGTTTGGGG + Intergenic
1108252368 13:48579892-48579914 TAAACAATTATCTGTCTTTCTGG - Intergenic
1110080545 13:71304638-71304660 TCAAATATCTTCTGTGATTGAGG + Intergenic
1111069960 13:83152682-83152704 TGACCATTCATCTGTGTTTGAGG - Intergenic
1111434280 13:88185931-88185953 TCATCAATCCACTGTGTTTCTGG + Intergenic
1111435845 13:88207051-88207073 TCAAGCATTATCTATGTTTGAGG - Intergenic
1111855474 13:93631769-93631791 TCAACTAACTTCTGAGTTTGAGG - Intronic
1112615403 13:100999542-100999564 TCAACTATCATCTGGTTTAGTGG + Intergenic
1113298318 13:108986924-108986946 CTAATACTCATCTGTGTTTGGGG + Intronic
1113305291 13:109071449-109071471 TCATCATTCATCAGTGATTGAGG - Intronic
1113930669 13:113967370-113967392 GCAGAAAGCATCTGTGTTTGTGG - Intergenic
1114724319 14:24918737-24918759 TCAACAATCAGTTGTGTTCTAGG - Intronic
1115167175 14:30462031-30462053 TCAAGATTCTTCTGAGTTTGTGG + Intergenic
1117287445 14:54300600-54300622 TCATCATTCATCTCTGTTTTTGG - Intergenic
1121546257 14:94765825-94765847 TGAACAATCATCTTTTATTGAGG + Intergenic
1128842945 15:70864853-70864875 TCATCAGTCATCTGTGTATCCGG + Intronic
1129022382 15:72533281-72533303 ACAAAAATCAGCTGTGCTTGGGG - Intronic
1130010442 15:80149054-80149076 TCAACATTCCTCTGTATTTCTGG + Intergenic
1131603288 15:93872254-93872276 TCAAGAATCATCTGGGTGTTAGG - Intergenic
1131893026 15:96994418-96994440 TCAACTTTCATCTGTATTTATGG - Intergenic
1134442312 16:14306489-14306511 TCTACATTTTTCTGTGTTTGGGG - Intergenic
1135001854 16:18783174-18783196 TCAACACTCATCAGTGGTTAAGG + Intronic
1138733525 16:59223376-59223398 TAAAAAAACATTTGTGTTTGGGG - Intergenic
1139774160 16:69303691-69303713 TCTTCAATCAAATGTGTTTGTGG + Exonic
1141557563 16:84846107-84846129 TAATCAATCATCAGTGTCTGGGG - Intronic
1148835780 17:50465081-50465103 TCAAGCATCATCTGTGTTGTTGG - Intronic
1149980022 17:61303318-61303340 TAAACAAGCACCCGTGTTTGGGG + Intronic
1151003237 17:70402359-70402381 TCAACAAGCTTCTGTGTATCTGG + Intergenic
1153396499 18:4627655-4627677 ACAACTAGCATCTGTGTCTGTGG - Intergenic
1153620491 18:6973076-6973098 TCAACACTCATGTTTGTTGGAGG - Exonic
1154061917 18:11070369-11070391 TCAACAAACATCTCTGTTCAGGG - Intronic
1155003755 18:21709687-21709709 TGAACCTTCATCTGTGTTTGGGG - Intronic
1155901936 18:31402163-31402185 TAAACAATCAGCTTTGTTTCTGG - Intronic
1156576249 18:38319299-38319321 TAAAAAATCATCTGTGTGTCTGG + Intergenic
1161024817 19:2031656-2031678 TCAAAAAGCACCTGTGTTTTCGG + Intronic
1166747605 19:45148848-45148870 TAAACAAACATCTTTTTTTGTGG - Intronic
927584577 2:24289805-24289827 TCAGCTATCATCAGTGTTAGTGG + Intronic
927610620 2:24535912-24535934 CCAACAATTATGTGTCTTTGGGG + Intronic
928901108 2:36318400-36318422 TCACAAATCTCCTGTGTTTGAGG - Intergenic
929954319 2:46443872-46443894 TCAACATTCCTCTGTGGTTAGGG - Intronic
931609531 2:64083668-64083690 TCAACAGGCCTCTGTGTTTGAGG + Intergenic
931715540 2:65025932-65025954 TAACAAAGCATCTGTGTTTGTGG + Intergenic
932394767 2:71435052-71435074 TAAAATACCATCTGTGTTTGTGG + Exonic
932876402 2:75456765-75456787 TCAACAGTCAGCTGTGCTTTCGG - Intergenic
935126554 2:100228954-100228976 TCATCAATCATATTTGATTGAGG + Intergenic
939062611 2:137441364-137441386 TCTACAATAATTTTTGTTTGAGG - Intronic
939993663 2:148900257-148900279 TCCACAATGATATGTGTTTAAGG - Intronic
940805716 2:158184260-158184282 TGAACAATGGTCTCTGTTTGGGG - Intronic
941501351 2:166281402-166281424 TCACCCAACATCTGTCTTTGTGG + Intronic
941972281 2:171364481-171364503 TCAAAAATCTTCTATTTTTGAGG - Intronic
942032157 2:171973272-171973294 TCAAGACTCATATGTGGTTGAGG - Intronic
942558013 2:177191308-177191330 TTAACAATAATGTATGTTTGAGG + Intergenic
943318483 2:186416754-186416776 TCCATAAACATTTGTGTTTGAGG - Intergenic
944172537 2:196795694-196795716 TTCACCATCAACTGTGTTTGTGG - Intronic
944319435 2:198321053-198321075 TCAACATTTACCTGTTTTTGTGG - Intronic
945950541 2:216035001-216035023 TCAGCAATGATCTGTGTTGCAGG - Intronic
1169439931 20:5625579-5625601 TCAACATTTTTCTGGGTTTGGGG + Intergenic
1170767453 20:19302590-19302612 GCAACCATCATCTTTATTTGGGG + Intronic
1179140114 21:38717944-38717966 CCCACAGTCATCTGTGGTTGAGG + Intergenic
1183445813 22:37854027-37854049 TCAACTGTCATCTGTATCTGCGG - Intronic
1183940108 22:41289319-41289341 TCAAGAATCATCACTGTTTCTGG + Intergenic
1184966538 22:47977167-47977189 TCATAAATCATCTGTCTATGGGG + Intergenic
949188047 3:1217848-1217870 TCAACAATCCTCAATATTTGGGG + Intronic
950958074 3:17076457-17076479 TGAATAAGCATCTGTGATTGTGG - Intronic
951677335 3:25257121-25257143 TCAACCATCATATGTGTTGCTGG - Intronic
952056415 3:29452250-29452272 TCAACAATCCTCAGGGTGTGTGG + Intronic
956917254 3:73884984-73885006 TAAAAAATCATCTGGGCTTGTGG - Intergenic
957702521 3:83734767-83734789 TCCCCATTCATCTCTGTTTGTGG - Intergenic
958915859 3:100049253-100049275 TCATTTATCATCTGTTTTTGAGG + Intronic
959094858 3:101943760-101943782 TCAATAATCAGATGTCTTTGTGG - Intergenic
959225341 3:103574914-103574936 TGAATAATCTTCTGTGTCTGGGG - Intergenic
959358401 3:105360631-105360653 TTATGAATCATCTATGTTTGTGG + Intergenic
960067529 3:113390062-113390084 TCAATATTCATCTGTGATAGTGG - Intronic
960174263 3:114498503-114498525 TCAACCATCAACTGTGTCTATGG + Intronic
960554672 3:119014510-119014532 TCAAAAATCATCTCTTCTTGGGG - Intronic
961973652 3:130997706-130997728 TCATCAATAATCATTGTTTGTGG + Exonic
963895222 3:150678485-150678507 TCATCAATTATCTGTTTTTCTGG + Exonic
969320145 4:6407222-6407244 TCAACATTCATCTCTGATTAAGG - Intronic
971109276 4:23564875-23564897 TCTAGAATCATCTGTGTTAATGG - Intergenic
972043656 4:34637155-34637177 AAAAAAATCATATGTGTTTGTGG - Intergenic
975700295 4:77059474-77059496 ACAACAATGTTTTGTGTTTGTGG + Intronic
976789544 4:88862586-88862608 TCAACAAAGATTAGTGTTTGGGG - Intronic
977317192 4:95465183-95465205 TCAGCATTCCTCTGTCTTTGTGG - Intronic
977480630 4:97570394-97570416 TCAACAATCATTTATATTTTGGG - Intronic
977891888 4:102321744-102321766 TCACCAATCATTTGCATTTGGGG - Intronic
979009269 4:115346006-115346028 TCACCAATCATCTGTCAATGTGG - Intergenic
980299825 4:130974907-130974929 TCATGAATCATTTCTGTTTGTGG + Intergenic
980688452 4:136260661-136260683 TCAAGCATCAGCTGTGCTTGGGG - Intergenic
981729480 4:147882597-147882619 ACAACATTCATTTGTGTGTGGGG + Intronic
982131204 4:152230341-152230363 TCAGCAATCATCTGGCTTAGAGG - Intergenic
982493426 4:156058877-156058899 TCCACAATACCCTGTGTTTGAGG + Intergenic
988422287 5:31021197-31021219 TCATTAATCATCAGTGTCTGTGG - Intergenic
989373597 5:40735633-40735655 TCAACAATCATCTGTGTTTGTGG - Intronic
989745856 5:44828711-44828733 TCATCAATCATCTGGGACTGTGG - Intergenic
989985550 5:50692770-50692792 TCATCATTCCTCTGTCTTTGAGG + Intronic
991252180 5:64575924-64575946 TCAACATTCCTCAGTGTTTCCGG - Intronic
992142768 5:73816100-73816122 TCAACAAACATCTGGGGTGGGGG + Intronic
992149082 5:73883951-73883973 TAAACAGCCATCAGTGTTTGTGG + Intronic
993934231 5:93981554-93981576 TGGATAATCATCTGTGTTTCAGG - Intronic
994268867 5:97753073-97753095 TCAACATACATGTGGGTTTGGGG + Intergenic
994704419 5:103183455-103183477 GCAACAAACAGCTGTCTTTGAGG + Intronic
994925468 5:106112600-106112622 TCAACAATTATCTGTTTATTTGG - Intergenic
996604933 5:125310561-125310583 TCAAGGAGCATCTGTGTCTGAGG - Intergenic
996677202 5:126190070-126190092 ACACCAATTACCTGTGTTTGAGG - Intergenic
996727511 5:126685406-126685428 TCTACAATAATCTGTGATGGTGG + Intergenic
997308573 5:132859814-132859836 TCAACACTCATCTGACTTTTGGG - Intergenic
997391252 5:133518935-133518957 TTAACAATAATCTTTGTATGTGG + Intronic
998513816 5:142735437-142735459 TCACCAATCGTCTGAGTCTGAGG + Intergenic
998805480 5:145914241-145914263 TCAACAAGCAGCTGTCTTTATGG + Intergenic
998972971 5:147612539-147612561 TCAGAAATTATCTATGTTTGTGG + Intronic
1003839972 6:10109774-10109796 ACAATAATCATCAGTATTTGTGG - Intronic
1004606214 6:17197291-17197313 TCAAAAAGCAACTGTATTTGCGG + Intergenic
1008603035 6:53114219-53114241 TCAACAATCCTCTTATTTTGAGG + Intergenic
1010068584 6:71715573-71715595 TGAACATGCATCTGTGTTTATGG + Intergenic
1012369533 6:98486327-98486349 TCATAAAGCATCTGTCTTTGGGG - Intergenic
1012516446 6:100066263-100066285 TCCACCATCTTCTGTTTTTGTGG + Intergenic
1012722333 6:102760900-102760922 TCAACAATCATATGTATTTATGG + Intergenic
1014354884 6:120395444-120395466 TCAAAAATCATATGGTTTTGGGG - Intergenic
1019138443 6:169927380-169927402 ACAACAATCATCTTTGAATGTGG - Intergenic
1021457918 7:20849404-20849426 AAAACAATCATTTGTGTATGTGG + Intergenic
1022024173 7:26430389-26430411 TCAGCAAGCATTTGTTTTTGGGG + Intergenic
1022412822 7:30152487-30152509 TGAATCATCATCTGCGTTTGAGG + Intronic
1024095465 7:45979262-45979284 TAAATCATCATCTCTGTTTGTGG + Intergenic
1026022161 7:66717454-66717476 TCAATAATCATATGTATTTTAGG + Intronic
1026256432 7:68716074-68716096 TCAGCTATCTTCTGAGTTTGGGG - Intergenic
1027475351 7:78623905-78623927 GCATCACTCATTTGTGTTTGTGG + Intronic
1032590917 7:133191705-133191727 CCAGCAATCTTCTGGGTTTGGGG + Intergenic
1033216738 7:139498902-139498924 TCACCCATCATCTCAGTTTGGGG - Intergenic
1033237177 7:139647371-139647393 TCAGCAAACATCTGTGTATTGGG - Intronic
1034126280 7:148674802-148674824 GACACAATCCTCTGTGTTTGGGG + Intergenic
1034541692 7:151762590-151762612 CCAAGCATCCTCTGTGTTTGGGG + Intronic
1034855610 7:154543684-154543706 TCAACAATCTAAAGTGTTTGTGG - Intronic
1037220677 8:16516381-16516403 TCAAAAATCATGTCTTTTTGTGG + Intronic
1039671861 8:39610239-39610261 TCAACAAATATATTTGTTTGTGG + Intronic
1040897183 8:52380963-52380985 TCAACAATCATCTCTCCTTCTGG + Intronic
1041282235 8:56222305-56222327 TCAACAAATGTGTGTGTTTGAGG + Intergenic
1042051196 8:64709794-64709816 TCAACAATCTTAAGTGTTTCTGG - Intronic
1042351259 8:67780041-67780063 CCAGAAAACATCTGTGTTTGGGG + Intergenic
1042994670 8:74682935-74682957 TCAATCATATTCTGTGTTTGTGG - Intronic
1044127228 8:88473815-88473837 GGAACAATCATATGTTTTTGGGG + Intergenic
1044173550 8:89087766-89087788 TCAGAAATCATCTTTTTTTGTGG + Intergenic
1045770234 8:105728868-105728890 TCAAAAAGCAGCTGTGTTCGGGG + Intronic
1047534330 8:125705445-125705467 TCAATACTCATGTGTTTTTGTGG + Intergenic
1047681258 8:127256748-127256770 TCAAATGTCATGTGTGTTTGTGG - Intergenic
1048942083 8:139408692-139408714 TTACCAAACATCTGTATTTGTGG + Intergenic
1054875688 9:70094053-70094075 GGAACAAACATCTGTGGTTGTGG + Intronic
1057387739 9:94619484-94619506 TCAACAGTCATTTGTTGTTGAGG + Intronic
1058621738 9:106890267-106890289 TCCACAATCATTTGTGTGTGTGG + Intronic
1060559015 9:124527626-124527648 TCACCAATTAACTGTATTTGTGG - Intronic
1191653328 X:63565833-63565855 TCAACTATAATCTTTGTTTCAGG - Intergenic
1192370648 X:70510030-70510052 TCAACTATCATCTTTTCTTGAGG + Intergenic
1194869687 X:99113823-99113845 GCAACAATAAGTTGTGTTTGAGG - Intergenic
1195891125 X:109696565-109696587 CCTACAGTCATCTGTGTGTGGGG - Intronic
1196429088 X:115603107-115603129 TCAGCAAAGATCTGTGTTTAGGG + Intronic
1197172175 X:123446503-123446525 TAAACAGTCATCTCTCTTTGAGG - Intronic
1199854803 X:151751646-151751668 TCAGCTATCATCTGTATTTGTGG + Intergenic
1200112163 X:153746101-153746123 CCATCAATCATCTGTTTTTGAGG - Intergenic
1200126255 X:153816312-153816334 CCAACAATCAGGTGTGTTGGGGG + Intronic