ID: 989373599

View in Genome Browser
Species Human (GRCh38)
Location 5:40735649-40735671
Sequence TTGTTGATCTGGAGAGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989373597_989373599 -7 Left 989373597 5:40735633-40735655 CCACAAACACAGATGATTGTTGA 0: 1
1: 0
2: 2
3: 9
4: 194
Right 989373599 5:40735649-40735671 TTGTTGATCTGGAGAGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989373599 Original CRISPR TTGTTGATCTGGAGAGCAAA AGG Intronic
No off target data available for this crispr