ID: 989378552

View in Genome Browser
Species Human (GRCh38)
Location 5:40791052-40791074
Sequence CTCACTGCACAGTGATGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989378552_989378560 -6 Left 989378552 5:40791052-40791074 CCCCACCATCACTGTGCAGTGAG 0: 1
1: 0
2: 3
3: 21
4: 218
Right 989378560 5:40791069-40791091 AGTGAGAGGGACAAAGGGCTTGG 0: 1
1: 0
2: 1
3: 44
4: 469
989378552_989378561 -1 Left 989378552 5:40791052-40791074 CCCCACCATCACTGTGCAGTGAG 0: 1
1: 0
2: 3
3: 21
4: 218
Right 989378561 5:40791074-40791096 GAGGGACAAAGGGCTTGGCATGG 0: 1
1: 0
2: 4
3: 33
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989378552 Original CRISPR CTCACTGCACAGTGATGGTG GGG (reversed) Intronic
900578470 1:3395782-3395804 CTCACTGAGCAGTGCTGTTGGGG - Intronic
900903311 1:5532199-5532221 CTGTCTGCACAGTGTTGGGGAGG + Intergenic
901479415 1:9514517-9514539 CTCACTGCTCAGTGCTGCTTGGG - Intergenic
902552169 1:17225613-17225635 CTCACTGCACAAGGATGAGGTGG + Intronic
902847559 1:19123881-19123903 GACACTGCCCAGTGATGCTGAGG + Intronic
902880889 1:19371113-19371135 CTCACTACACCCTGATGATGTGG + Intronic
903017041 1:20367817-20367839 CTCTGTCCACAGTGATGGTGAGG - Intergenic
904945601 1:34196728-34196750 CTCACTGCAGAATGGTGGAGTGG - Intronic
905524391 1:38625285-38625307 CCAACTGGACAGTGAAGGTGTGG + Intergenic
905879217 1:41452620-41452642 CCCACTTCACAGGGTTGGTGTGG + Intergenic
905902048 1:41588192-41588214 CTGGCTGCACTGTGATGGAGAGG + Intronic
906226807 1:44129456-44129478 CTCACAGCGCAGAGATGCTGGGG + Exonic
908887871 1:68810755-68810777 ATCACTTCACAGTGAAAGTGGGG - Intergenic
908966416 1:69770039-69770061 TTCACAGAACAGTGATGGTCTGG + Intronic
909108123 1:71438846-71438868 CTCACTGGCCAGTGATGGCGTGG + Intronic
909215301 1:72879029-72879051 CTCACAGCTCTGAGATGGTGTGG + Intergenic
909267301 1:73577103-73577125 ATCTCTGCACAGGAATGGTGTGG - Intergenic
912450822 1:109766501-109766523 CCCACTGCCCAGGGCTGGTGGGG + Intronic
914260336 1:145993850-145993872 CTCACTGCACATTGTTGTTGAGG + Exonic
916939028 1:169661322-169661344 CTCACTGCCCAGGGCTGGTGGGG - Intergenic
916940065 1:169668160-169668182 CTCACTGCCCAGGGCCGGTGGGG - Intronic
917779138 1:178372651-178372673 CTCTCAATACAGTGATGGTGAGG + Intronic
919297771 1:195723125-195723147 CTCACTGCCCAGGGCCGGTGGGG + Intergenic
920329000 1:205191354-205191376 CACACTGCTCAGTGATGTGGTGG + Intronic
920807451 1:209248481-209248503 TTCAGAGCTCAGTGATGGTGAGG + Intergenic
922068903 1:222171093-222171115 CTCACTGCTCAGTTCTAGTGTGG - Intergenic
922553762 1:226517608-226517630 CTGACTCCACAGGGAAGGTGGGG - Intergenic
923112290 1:230901903-230901925 CTCAGTGGAGAGTGGTGGTGGGG - Intergenic
1063115516 10:3068909-3068931 CGCACTGCACAGGGTTGGAGCGG + Intronic
1064293072 10:14053145-14053167 ATCACTGCACAGTGTTTTTGTGG - Intronic
1065405825 10:25363172-25363194 ATCACTGCAAAGTTATGGTATGG - Intronic
1067828997 10:49599121-49599143 CTCCCTGCACAGAGATGGATCGG - Intergenic
1074683332 10:115933451-115933473 CTGACTTCACAGCGATGCTGTGG + Intronic
1076044757 10:127282859-127282881 GTCTCTGCAGAGTGATAGTGGGG + Intronic
1077029472 11:457900-457922 CACAATGCAGAGTGCTGGTGAGG - Intronic
1077343435 11:2036036-2036058 CTCACGGCACCTTGCTGGTGAGG + Intergenic
1077583798 11:3435199-3435221 CTCACTGCCCAGGGACGGCGGGG + Intergenic
1077764583 11:5144520-5144542 CTCACTGCCCAGGGCCGGTGGGG - Intergenic
1079190985 11:18276348-18276370 CTCACTGCCCAGGGCCGGTGGGG + Intergenic
1080267620 11:30418020-30418042 CTCCCCTCACAGTGATTGTGAGG - Intronic
1080503087 11:32888423-32888445 CTCACTGCCCAGGGCTGGCGGGG + Intergenic
1081196747 11:40170444-40170466 CTCACTGCACAGTGAATGAAGGG + Intronic
1085636520 11:78163466-78163488 CTCTCTGCTCAGGAATGGTGGGG + Intergenic
1085637095 11:78167336-78167358 CTCTCTGCTCAGGAATGGTGGGG + Intergenic
1086168559 11:83808783-83808805 CACACTGCACTGTAAAGGTGTGG + Intronic
1086534180 11:87824091-87824113 CTGTCTGCACAGAGATGGGGAGG - Intergenic
1086693219 11:89812812-89812834 CATACTGCACAGGAATGGTGAGG - Intergenic
1087245201 11:95827009-95827031 CTCACTGCAGAGTTAGGGTTTGG - Intronic
1088570042 11:111213800-111213822 GTCCCAGCACAGTAATGGTGGGG + Intergenic
1088985330 11:114900470-114900492 TTCCATGCACAGTAATGGTGTGG - Intergenic
1089182007 11:116589758-116589780 CTGATTGCACAGTGAGTGTGGGG - Intergenic
1089365808 11:117920280-117920302 CCCAATACACAGTGAGGGTGTGG + Intronic
1089667493 11:120029651-120029673 CTCACAGCACAGGGATGGCCTGG - Intergenic
1090782718 11:130021778-130021800 CTCACTGCCCAGGGCTGGTAGGG - Intergenic
1091251265 11:134146185-134146207 CCCACTGCACAGTGAAGGGAAGG + Intronic
1202826421 11_KI270721v1_random:91225-91247 CTCACGGCACCTTGCTGGTGAGG + Intergenic
1092041640 12:5390191-5390213 CTCACAGCACAGTGCACGTGTGG - Intergenic
1096769257 12:53923686-53923708 CTCCCTGCACAGATAGGGTGTGG + Intergenic
1100589541 12:96012954-96012976 CTTTCTGCACAAGGATGGTGAGG - Intronic
1101239492 12:102824204-102824226 CTCACTGTACAGTGAAACTGAGG - Intergenic
1105398301 13:20062330-20062352 CATACTGCAAGGTGATGGTGGGG - Intronic
1107142943 13:37023271-37023293 TACACTGCACAGTGATAGGGTGG - Intronic
1111496893 13:89062296-89062318 ATCTCTGCACAGGAATGGTGGGG + Intergenic
1112223307 13:97513463-97513485 ATCTCTGCACAGGAATGGTGGGG + Intergenic
1113937618 13:114002738-114002760 CTCACTGCACAGCTCTGGTCTGG + Intronic
1113948335 13:114057583-114057605 CTCTGTGCACAGTCATTGTGGGG - Intronic
1117449807 14:55839614-55839636 CTCACTGCCCAGGGCTGGTGGGG - Intergenic
1119982636 14:79099300-79099322 CTCACTGCACAGAGAGGGAGAGG + Intronic
1120229778 14:81829711-81829733 CTCACTGCCCGGGGCTGGTGGGG + Intergenic
1121471038 14:94154593-94154615 ATAACTGCAGAGTGAAGGTGGGG - Intronic
1122137651 14:99644261-99644283 CTCACTGGACAGAGAAGATGGGG + Intergenic
1122839133 14:104446264-104446286 TGCACTGCACAGTGGTGGCGGGG - Intergenic
1122910967 14:104827377-104827399 ATCAGTGAACAGTGACGGTGGGG + Intergenic
1123053940 14:105560474-105560496 CTCCCTGCAATGCGATGGTGAGG - Intergenic
1123078525 14:105680891-105680913 CTCCCTGCAATGCGATGGTGAGG - Intergenic
1124158896 15:27251922-27251944 CTTACTGCACAGCTATGCTGAGG - Intronic
1127391534 15:58508768-58508790 CTTCCTGCACAGTGCTGGAGAGG - Intronic
1127803370 15:62496479-62496501 CTCTCTGCAAAGTGTGGGTGAGG - Intronic
1128739794 15:70075804-70075826 CCCACTGCCCACTGATGGTTAGG + Intronic
1129299658 15:74618325-74618347 CTCACTGAACAGGGATAGTGAGG + Intronic
1129683162 15:77669669-77669691 ATTACTGAACAGTGATGGAGAGG - Intronic
1129758252 15:78111655-78111677 CTGTCTGCACAGTGATGTGGAGG - Intronic
1133906399 16:10026620-10026642 TTCACTGCACAGTCAAGCTGGGG + Intronic
1134703592 16:16285485-16285507 CCCACTGCTCAGAGATGGCGAGG + Exonic
1134963951 16:18426629-18426651 CCCACTGCTCAGAGATGGCGAGG - Exonic
1134968238 16:18509165-18509187 CCCACTGCTCAGAGATGGCGAGG - Intronic
1135088052 16:19490551-19490573 CTCACAGCACAATGAGGGTGAGG - Exonic
1137295637 16:47090541-47090563 CTCACTGCTGGGTCATGGTGTGG + Intronic
1138168825 16:54829922-54829944 CTCACTGCACCGGGCCGGTGGGG - Intergenic
1140756965 16:78076321-78076343 CACACTGCATAGTGCTGGAGGGG + Intergenic
1143240390 17:5438836-5438858 CTCGCTGCACACCGACGGTGAGG - Exonic
1143814613 17:9502083-9502105 ATCCCTGCACACTGTTGGTGGGG + Intronic
1143895662 17:10134537-10134559 ATCTTTGCACAGTGTTGGTGGGG - Intronic
1146935446 17:36809982-36810004 CTCACTGCAGTGGGAAGGTGCGG + Intergenic
1147501789 17:40972520-40972542 CCCACTGCACATTTATTGTGGGG + Intergenic
1147905719 17:43821541-43821563 CCCACTGAAAAGTGATGGTGAGG - Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150696928 17:67413572-67413594 CTGACTGGATAGTGGTGGTGGGG - Intronic
1151784702 17:76269837-76269859 CTCCCTGCCCAGGGAAGGTGCGG + Intronic
1152302514 17:79503637-79503659 CACACTGCACGGTGCAGGTGAGG + Intronic
1152364757 17:79849220-79849242 CTCACTGCAGAGTGGCAGTGGGG + Intergenic
1155587045 18:27378340-27378362 CTCACTGGGCAGTAATGGAGTGG + Intergenic
1157202268 18:45669121-45669143 CTCCCTGCACAGTGACAGGGTGG - Intronic
1160108990 18:76007131-76007153 CTCACTGGGCAGTGGTGGTTGGG + Intergenic
1160412847 18:78686722-78686744 CACACAGCACAGGGAGGGTGTGG - Intergenic
1160902670 19:1436525-1436547 TGCACTGCACAGGGATGTTGGGG - Intergenic
1162447143 19:10730518-10730540 TTCACTGCACAGTCATGGAGGGG + Intronic
1162687610 19:12400743-12400765 CTCACTGCACCGAGACGCTGAGG - Intronic
1163712435 19:18854772-18854794 CCCACTCCACAGTGACGGGGAGG - Intronic
1165222462 19:34328064-34328086 CTATCTGCACAGGGACGGTGGGG - Exonic
925818558 2:7777168-7777190 GTCATTGCACAGTGGAGGTGAGG - Intergenic
926066778 2:9846895-9846917 CTTACTACACAATGAGGGTGAGG - Intronic
926357717 2:12056677-12056699 CTGACTTCACACTGATGCTGTGG + Intergenic
928326635 2:30324386-30324408 CACACTGCACAGCGGTGGTCTGG - Intergenic
933420747 2:82042879-82042901 CTGACTGCACAGGGATGCTCAGG - Intergenic
935638859 2:105271646-105271668 CTCACTTCACAGGGTTGTTGTGG + Intronic
935900644 2:107788595-107788617 CCCAGTGCCCAGTGGTGGTGTGG + Intergenic
936156371 2:110049912-110049934 CTCACTGCATAGAGCTGATGAGG + Intergenic
936172711 2:110190443-110190465 CTCACTGCCCAGGGCCGGTGGGG + Intronic
936188318 2:110321530-110321552 CTCACTGCATAGAGCTGATGAGG - Intergenic
936467263 2:112764590-112764612 GTCACTGAAGAGTCATGGTGGGG - Exonic
936609926 2:113992229-113992251 CTCACTGTACAGTCATGGGGTGG - Intergenic
938110950 2:128564624-128564646 CTCACTGGGCAATGATGTTGTGG - Intergenic
938578770 2:132627672-132627694 CTCACTGCACAGTGCTGTTTTGG + Intronic
938745187 2:134271238-134271260 CTCAGAGCAGTGTGATGGTGGGG - Intronic
939104917 2:137937820-137937842 CACACTGCAAAGTCATGGTTTGG + Intergenic
940694016 2:156956299-156956321 ATCTCTGCACAGGCATGGTGGGG + Intergenic
940995255 2:160142657-160142679 CTCACTCCACGGTGATGTGGTGG - Intronic
942113641 2:172706845-172706867 CTCACTGGCCAGTAATGGAGTGG - Intergenic
942748849 2:179265121-179265143 CTCACTGCCAAGCGGTGGTGTGG + Intergenic
944886809 2:204071542-204071564 CTTCCTGGAAAGTGATGGTGGGG + Intergenic
945291898 2:208135166-208135188 CTCACTGACGAGTGATGGAGCGG - Intergenic
946969558 2:225076604-225076626 CACACTGCTCAGTCATTGTGGGG + Intergenic
947665212 2:231901103-231901125 CACACTGCACAGTGACGTGGGGG - Intergenic
948659634 2:239499071-239499093 CTCACCGCACAGCAGTGGTGTGG + Intergenic
1170552568 20:17490188-17490210 CTCTCTACCCAGTGATGCTGGGG - Intergenic
1171129079 20:22632107-22632129 CAGTCTGCACATTGATGGTGTGG + Intergenic
1172174251 20:32962511-32962533 CTCCCAGCAGAGTGGTGGTGGGG - Intergenic
1173011835 20:39190151-39190173 CTCACAGATCAGTGATGGAGGGG + Intergenic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1179511604 21:41877442-41877464 CTCCCCTCACAGTGCTGGTGTGG - Intronic
1179588378 21:42388655-42388677 GTCACTGCTCTGTGATGGGGAGG - Intronic
1181344349 22:22207238-22207260 ATCAGGGCCCAGTGATGGTGGGG + Intergenic
1182064419 22:27420489-27420511 CACACCTCACAGTGATGGTGTGG + Intergenic
1182165712 22:28170916-28170938 CTCTCTGCACAGAGAGGCTGGGG - Intronic
1185162200 22:49236791-49236813 CTCAATGGACAGAGATGGCGTGG - Intergenic
949260280 3:2097868-2097890 CACTTTGCACAGTGCTGGTGAGG + Intergenic
949918342 3:8982419-8982441 CTAACTGTACAGTGAGTGTGGGG - Exonic
950028713 3:9837965-9837987 CACACTGGAAAGTGAGGGTGGGG - Exonic
950785828 3:15434670-15434692 CTCACTGTTCAGAGATGGGGAGG + Intronic
951924232 3:27889369-27889391 CTCAATGAAAAGTGATGTTGTGG - Intergenic
953251591 3:41249354-41249376 CTCAGTGGACAGTGATGGGCTGG + Intronic
953392248 3:42540485-42540507 CTCTCTGCACAGGGATGGTGGGG - Intergenic
953880622 3:46689564-46689586 CTCACTGCTCAGTTCTGATGTGG - Intronic
954191703 3:48967140-48967162 CACACTGCACAGTGGTGAGGGGG - Exonic
954803508 3:53201425-53201447 CTCACGGCACAGTGCCTGTGGGG + Intergenic
954995826 3:54880784-54880806 CTCTCTGCACAGTTTAGGTGTGG + Exonic
955623441 3:60891059-60891081 GTCACTATACAGTGATGTTGTGG + Intronic
956128038 3:66029425-66029447 CTCCATCCACAGTAATGGTGGGG + Intronic
956597277 3:70981527-70981549 ACCACTGCACATTGATGGTGGGG - Intronic
957446124 3:80314599-80314621 CTCACTGCCCAGTACCGGTGGGG - Intergenic
962348529 3:134640196-134640218 CAGACTGCACATTGAGGGTGGGG + Intronic
962429675 3:135307518-135307540 CTCACTACACGGAGATGATGTGG - Intergenic
962924071 3:139975768-139975790 TTCACTGCAGAGAGGTGGTGGGG - Intronic
963743015 3:149098104-149098126 CTCACTGCCCAGGGTCGGTGGGG + Intergenic
963744151 3:149109494-149109516 CTCACTGCCCGGGGCTGGTGGGG - Intergenic
965446463 3:168780245-168780267 CTCACTGCCCGGGGCTGGTGGGG - Intergenic
966399846 3:179537067-179537089 CAGACTGCACAGTGATGGAGAGG + Intergenic
967451324 3:189626626-189626648 CTCTCTGCTCAGTCATGGTAGGG + Intergenic
967510576 3:190306521-190306543 CCCACCTCACAGTGATGTTGTGG - Exonic
968508636 4:984940-984962 CTCACTGCACGGTGCTGGAATGG - Intronic
970026154 4:11626121-11626143 CTCACTGCACAGGTATTATGAGG - Intergenic
970030273 4:11666222-11666244 CTCTGTGAACAGTGAAGGTGTGG + Intergenic
976500564 4:85783921-85783943 CTCACTGCACAACGATGTTCAGG + Intronic
980189927 4:129511259-129511281 CTCAATGCACAGTTGTGGTTTGG + Intergenic
980851502 4:138388265-138388287 CTCACCCCACAGGGATGGTGTGG + Intergenic
985946512 5:3188929-3188951 CTTACTGCACACTGATGGAAGGG + Intergenic
986520540 5:8613041-8613063 ATCACTGCAAAGGGATGTTGAGG - Intergenic
989378552 5:40791052-40791074 CTCACTGCACAGTGATGGTGGGG - Intronic
990112817 5:52348925-52348947 CTCACTGGACATTGTTGTTGTGG + Intergenic
992107845 5:73464864-73464886 CTAACTTCACAGTGTTGTTGTGG - Intergenic
992469170 5:77039100-77039122 ATGACTGCACAATAATGGTGTGG - Intronic
994986731 5:106942778-106942800 CTCAATGCACAGTGAAAATGTGG - Intergenic
995148212 5:108810642-108810664 GTCTCTGCACAGGAATGGTGGGG + Intronic
997251443 5:132391759-132391781 CTCTGGGCACAGTGATGGAGAGG - Intronic
999194232 5:149771255-149771277 CCCACTGCACAGTCATCCTGAGG + Intronic
999255606 5:150208576-150208598 CTCACAGCACAGTGATACTTAGG - Intronic
1002182843 5:177440463-177440485 CTCACTGCTCAATGACTGTGAGG - Intronic
1002192180 5:177484044-177484066 CCCACTGGCCAGTGAGGGTGAGG - Intronic
1002363875 5:178695202-178695224 CTCAGGGCACAAGGATGGTGGGG + Intergenic
1002814821 6:669713-669735 AGGACTTCACAGTGATGGTGTGG + Intronic
1002832853 6:839388-839410 CCCACTGTGGAGTGATGGTGGGG - Intergenic
1002904157 6:1435406-1435428 TGCACTGAACAGTGATGGTGAGG + Intergenic
1007738727 6:43998206-43998228 CTCACTGCCCAGGGCCGGTGGGG - Intergenic
1008626256 6:53319735-53319757 TTCACTGCACTGTGCTGGTTCGG + Intronic
1010864171 6:80952820-80952842 GTCAAAGCACAGTGATGGTTTGG - Intergenic
1011129348 6:84037736-84037758 CTCACTGCCCAGGGCTGGTGGGG + Intronic
1013770110 6:113619289-113619311 CTTACTGCAACGTTATGGTGTGG - Intergenic
1014074038 6:117216162-117216184 ATCACTGTATAGTGATTGTGAGG - Intergenic
1014978673 6:127921048-127921070 CCCACTGCACAGAGATGGCCTGG + Intergenic
1016859733 6:148705656-148705678 CTCAGTGCACGCTCATGGTGGGG - Intergenic
1018072109 6:160173981-160174003 CTCCCTGCTCAGGGAGGGTGAGG + Intronic
1018859804 6:167703547-167703569 ATCACTGCACAGTGTGTGTGTGG + Intergenic
1019139696 6:169935649-169935671 CTCACTGAACGGGGATTGTGCGG - Intergenic
1022694655 7:32692480-32692502 CTCACTACACAGAGATGGTGTGG - Intergenic
1022927836 7:35073980-35074002 CTCACTACACAGAGATGGTGTGG - Intergenic
1023042223 7:36181720-36181742 CCCACTGCTCCGTGATGCTGAGG - Intronic
1024405103 7:48969978-48970000 ATCTCTGCACAGGAATGGTGAGG - Intergenic
1028303301 7:89228981-89229003 CTCACTGCCCAGTGCCGGCGGGG + Intronic
1030284544 7:107812201-107812223 CTCACAGCACAGTGTTTTTGAGG + Intergenic
1031077662 7:117228329-117228351 CTCAAAGCCCAGTGATGGAGGGG - Intronic
1031567690 7:123320768-123320790 CTCACTGTGCAGTGATGAAGTGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033065075 7:138146271-138146293 CTCACTGCCCGGGGCTGGTGGGG - Intergenic
1035168103 7:157003413-157003435 CTGGCTGCCCAGTGTTGGTGAGG + Intronic
1035198061 7:157239766-157239788 CACCCTGCAAAGTGAGGGTGTGG + Intronic
1043034486 8:75178949-75178971 CTCACTGCACTATGATTGAGAGG - Intergenic
1043403614 8:79908422-79908444 CTGACTGCACAGAGATTCTGTGG + Intergenic
1043921042 8:85983603-85983625 CTCACTGCACAGTGCAGGGAGGG + Intergenic
1044404884 8:91816470-91816492 CTCACTGCCCAGGGCTGGTGGGG - Intergenic
1044955543 8:97476004-97476026 ATCTCTGCACAGGAATGGTGGGG - Intergenic
1046011700 8:108556447-108556469 CATACTGCACAGTGTTGTTGTGG + Intergenic
1048300635 8:133248710-133248732 CTCACTGCAGGGTGACTGTGTGG + Exonic
1049206486 8:141365989-141366011 GTCACTGCTGAGTGATGGAGTGG + Intronic
1052641947 9:31180109-31180131 GGCACTGCACTGTGCTGGTGGGG - Intergenic
1053363023 9:37502985-37503007 CTCCCTGAACAGTCATGTTGAGG + Intronic
1053785244 9:41648540-41648562 CTCTCTGGACGGTGTTGGTGGGG - Intergenic
1054173969 9:61862489-61862511 CTCTCTGGACGGTGTTGGTGGGG - Intergenic
1054448829 9:65391556-65391578 CTCTCTGGACGGTGTTGGTGGGG - Intergenic
1054663569 9:67718292-67718314 CTCTCTGGACGGTGTTGGTGGGG + Intergenic
1056305750 9:85289152-85289174 CTCACTGCCCCGGGCTGGTGGGG - Intergenic
1056711853 9:88997971-88997993 ACCACTGCACAGTGCTGATGGGG - Exonic
1057179520 9:93022223-93022245 CTCAATGCACAGAGGTGCTGGGG + Intronic
1057227424 9:93299774-93299796 TTCTCTGGACAGAGATGGTGAGG - Intronic
1061119365 9:128633825-128633847 CCCAGGGCACAGTGAAGGTGTGG - Exonic
1185935816 X:4256644-4256666 CTCACTATACAGTACTGGTGTGG + Intergenic
1188166964 X:26873911-26873933 CTCACTGCCCGGGGCTGGTGGGG + Intergenic
1194894860 X:99427998-99428020 CTCATTGCAGACTGATGGAGTGG - Intergenic
1195796722 X:108656657-108656679 GACACTGCCCAGTGATGGTGAGG - Intronic
1197388142 X:125826504-125826526 CTCCCTCCACAGTGCTGGTCTGG - Intergenic
1199543502 X:148983416-148983438 TTCCCTGCAGAGTTATGGTGAGG + Intronic
1199719329 X:150530959-150530981 CACACTGCACTGTGATTGTGTGG - Intergenic
1202019201 Y:20447854-20447876 CTCACTGAACAGTCATGAAGGGG + Intergenic