ID: 989380133

View in Genome Browser
Species Human (GRCh38)
Location 5:40802358-40802380
Sequence TACTCTCTCGAGGCTGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989380133_989380136 -9 Left 989380133 5:40802358-40802380 CCTACTTCAGCCTCGAGAGAGTA No data
Right 989380136 5:40802372-40802394 GAGAGAGTAGCTAGGACTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989380133 Original CRISPR TACTCTCTCGAGGCTGAAGT AGG (reversed) Intergenic
No off target data available for this crispr