ID: 989390339

View in Genome Browser
Species Human (GRCh38)
Location 5:40894066-40894088
Sequence ATTCAGCAGCAGCACACTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989390339_989390340 -7 Left 989390339 5:40894066-40894088 CCTATAGTGTGCTGCTGCTGAAT No data
Right 989390340 5:40894082-40894104 GCTGAATACCCACTCTAATTTGG No data
989390339_989390343 5 Left 989390339 5:40894066-40894088 CCTATAGTGTGCTGCTGCTGAAT No data
Right 989390343 5:40894094-40894116 CTCTAATTTGGCATTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989390339 Original CRISPR ATTCAGCAGCAGCACACTAT AGG (reversed) Intergenic
No off target data available for this crispr