ID: 989392429

View in Genome Browser
Species Human (GRCh38)
Location 5:40915210-40915232
Sequence ATCCAGTTGGAGTCTGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989392429 Original CRISPR ATCCAGTTGGAGTCTGGTGA TGG (reversed) Intronic
900747652 1:4372220-4372242 ATACCATTGGAGTCAGGTGATGG - Intergenic
900934493 1:5756552-5756574 AGGCATTTGGTGTCTGGTGAGGG + Intergenic
905485420 1:38292567-38292589 AGCCAGCTGGAGGGTGGTGAAGG - Intergenic
905717511 1:40165226-40165248 AACAAGTTGGATTCAGGTGATGG - Intronic
905809096 1:40899018-40899040 TTCCAGTTGGTGTCTGCTCAGGG - Intergenic
905952196 1:41961243-41961265 ATGCAGTTACAGTCTGATGATGG - Intronic
907529105 1:55075326-55075348 ATACAGTAGAAGTCTGGTCAGGG - Intronic
908031030 1:59999984-60000006 ATCCAGTAGGAGTGCTGTGATGG - Intronic
908514887 1:64882516-64882538 ATCCACTTGGATTGTGATGATGG - Intronic
909510099 1:76442862-76442884 ATCCAGCAGGAGTCTGATGGAGG - Intronic
911105125 1:94123875-94123897 ATAGATTTGGTGTCTGGTGAGGG + Intergenic
912668743 1:111606630-111606652 CTCCAGTAGGAGTGTGGTGGTGG - Intronic
913046620 1:115078650-115078672 GTCAGGTTGGATTCTGGTGAGGG - Intronic
915776920 1:158500566-158500588 ATCCACTTGGCTTCTGGTGAAGG + Intergenic
919880893 1:201899828-201899850 GTCCAGGTTGAGGCTGGTGATGG + Exonic
920128572 1:203713139-203713161 ATCCAGGTGTGGTCTGGTGTTGG + Intronic
922082663 1:222312134-222312156 ACAGAGTTGGCGTCTGGTGAGGG + Intergenic
923790436 1:237106796-237106818 AGCAATTTGGTGTCTGGTGAAGG + Intronic
1063437445 10:6045962-6045984 GTCCAGTTGGTGTCAGGTGAGGG + Intronic
1064013114 10:11751783-11751805 ATCCTGTTGAAGTTTGGAGACGG + Intronic
1065758783 10:28962107-28962129 CAGCAGATGGAGTCTGGTGAGGG - Intergenic
1067792726 10:49299982-49300004 ACCCTGTGGGAGTCTGGTGGGGG - Intronic
1069296302 10:66849012-66849034 ATCCATCTGGAATCTGGGGATGG - Intronic
1075683338 10:124347755-124347777 CTCCAGCTGGTGTCTGGTGGCGG + Intergenic
1077947853 11:6921725-6921747 ATCCAGATGCAGTCTGGGGAAGG + Exonic
1079054386 11:17193121-17193143 ATCCGCTTGGCATCTGGTGAGGG - Intronic
1079587164 11:22140097-22140119 TTTCTGTTGGTGTCTGGTGAGGG - Intergenic
1080943074 11:36941076-36941098 GTACAGTTGGGTTCTGGTGAGGG + Intergenic
1081792147 11:45795729-45795751 ATCTGGTTGAAGTCTGGTGGGGG - Intergenic
1082223416 11:49670969-49670991 AACCAGTTTGAGTCAGGTGCAGG - Intergenic
1086625638 11:88948300-88948322 AACCAGTTTGAGTCAGGTGCAGG + Intronic
1087801500 11:102509510-102509532 ATCTGGTTGGCTTCTGGTGAGGG - Intergenic
1089704187 11:120265506-120265528 CTCCACTTGGAGCCTGATGATGG - Intronic
1093586819 12:20847477-20847499 ACACAGTTGAATTCTGGTGAAGG - Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1099941587 12:89195400-89195422 AGCCAGTGGGACTCTAGTGAAGG - Intergenic
1100216210 12:92451447-92451469 ATCCACTTGGCTTCTCGTGAGGG + Intergenic
1100342834 12:93697387-93697409 AAGCATTTGGTGTCTGGTGAGGG - Intronic
1100439246 12:94600582-94600604 ATCCACTTGGTGGATGGTGAAGG - Intronic
1101039844 12:100744373-100744395 ACCGATTTGGCGTCTGGTGAGGG + Intronic
1103056831 12:117828117-117828139 ATCCTCATGGAGTTTGGTGATGG - Intronic
1103089612 12:118088341-118088363 ATCCAGTTCAAGTGTGCTGAGGG + Intronic
1108966849 13:56317983-56318005 AGCCAGTTGCAGTGTTGTGAGGG + Intergenic
1110176617 13:72563964-72563986 ATCCAGTAGGAGTATGGGGTGGG - Intergenic
1112582431 13:100688066-100688088 ACCCAGATGAAGTCTGCTGATGG + Intergenic
1113789450 13:113019862-113019884 ATAGACTTGGTGTCTGGTGACGG - Intronic
1114764229 14:25352033-25352055 ATCTACTTGGCTTCTGGTGAGGG + Intergenic
1114783166 14:25562927-25562949 ATCCATTTGAAGTTAGGTGAGGG - Intergenic
1115471404 14:33772328-33772350 GTCCAGTAGGAGTCTATTGAAGG - Intronic
1115718871 14:36137520-36137542 ATCCAGTTGCAGGGTGATGATGG + Intergenic
1115979253 14:39030854-39030876 ATAGAGTTGGTGTGTGGTGATGG - Intergenic
1116067554 14:40003419-40003441 AGCCAGTTTGAGAGTGGTGATGG + Intergenic
1116964354 14:50999090-50999112 ATCCAGTAGGTGTCTGGGGTAGG + Intronic
1117968734 14:61231936-61231958 ATCCAGCTGGCGTCTGTTGCTGG - Intronic
1119334180 14:73818702-73818724 TTCCTGATGGAGTCTGGTGCTGG - Intergenic
1123711440 15:22990584-22990606 ACAGAGTTGGTGTCTGGTGAGGG - Intronic
1124379517 15:29153381-29153403 AGCCTGTTGGATTCTGGTAAGGG + Intronic
1125066394 15:35490898-35490920 ATGGTGTTGGAATCTGGTGAGGG + Intronic
1125465446 15:39946758-39946780 ATCAAGGTGGTGGCTGGTGAAGG - Intronic
1127007324 15:54585015-54585037 AACCAATGGTAGTCTGGTGATGG - Intronic
1128174098 15:65538800-65538822 ATCCAGGTGGTGACTGCTGAAGG - Intronic
1129205178 15:74033222-74033244 ATCAAGATGGAGTCTGAGGAGGG + Exonic
1130616464 15:85413503-85413525 ATGGAGTTGAAGTCAGGTGAAGG + Intronic
1132312352 15:100866440-100866462 ATCCAGCTGCAGTCAGGTGGCGG + Intergenic
1132935364 16:2477763-2477785 ATCCAGCTGGATTGTGGTGGGGG + Intronic
1133499710 16:6354324-6354346 GTCCTGCTGGAGACTGGTGATGG - Intronic
1135500413 16:22991162-22991184 ATGCAGTTTGAGTCTGGAAAGGG - Intergenic
1136159879 16:28412852-28412874 ACCGATTTGGTGTCTGGTGAGGG + Intergenic
1136203209 16:28702440-28702462 ACCGATTTGGTGTCTGGTGAGGG - Intronic
1138033050 16:53576457-53576479 ATCCCGTGGGAGTCTAGTAATGG + Intergenic
1138507348 16:57485051-57485073 AGCCAGATGGAGGCTGGTGGTGG - Intronic
1139242362 16:65406263-65406285 ATCTGGTTGGTGTCTGGTGTGGG - Intergenic
1139251547 16:65501211-65501233 GTCAAGATGGAGTCTGGAGATGG + Intergenic
1139709582 16:68765533-68765555 ATCCATCTGGAGTTTGGTAACGG + Intronic
1141698961 16:85633717-85633739 TTCCAGCTGGACTCTGGGGACGG + Intronic
1141711692 16:85703287-85703309 GCACATTTGGAGTCTGGTGAGGG - Intronic
1143418553 17:6770214-6770236 CACCATTTGGTGTCTGGTGAGGG + Intronic
1144779609 17:17801212-17801234 ATCCAGATGGAGCCTGGCCATGG + Intronic
1146100077 17:29972636-29972658 AGCCAGTTGGGGTCTTGTGGCGG + Intronic
1148918050 17:51000724-51000746 ATTGAGATGGAGTCTTGTGATGG - Intronic
1149496667 17:57122600-57122622 AGCAAGTTGGAGGCTGGTGAAGG + Intergenic
1149881835 17:60299829-60299851 ATCAATTCGGTGTCTGGTGAAGG + Intronic
1154352797 18:13600557-13600579 ATTCAGCTGGAGTCTGATCAAGG + Intronic
1156568286 18:38221503-38221525 ATCCTGTTTAAGTCTGGGGATGG + Intergenic
1158945292 18:62442460-62442482 ATCGTGATGGACTCTGGTGATGG + Intergenic
1160578149 18:79868626-79868648 GTCCAGCTGGGGGCTGGTGAAGG + Intronic
1162334702 19:10053116-10053138 ATCAGGTTGTAGTCTGGGGAAGG - Intergenic
1163023823 19:14497799-14497821 AGCCAGTTGGAGTCTGGCTCAGG - Intergenic
1163452401 19:17386131-17386153 ATCCAGTTGCAGCCTCCTGAGGG - Intergenic
1165010270 19:32840863-32840885 ATCCACTTAGAGTCTGGAGTTGG + Intronic
925735088 2:6957043-6957065 TTCCAGTTGGAGTGTGCTGGGGG - Intronic
926248020 2:11134914-11134936 ATCCACTTGGCTTCTGGTAAGGG + Intronic
926410722 2:12599429-12599451 CTCCACTTGGAGTAGGGTGAGGG - Intergenic
929004191 2:37379614-37379636 TTGCAGTTGGATTCTGGTGTTGG + Intergenic
930069540 2:47354773-47354795 TTCCTGTTGGAGGCTGCTGAAGG - Intronic
930596117 2:53390175-53390197 ACCCTGTTAGAGCCTGGTGAGGG - Intergenic
934657108 2:96122173-96122195 ATCCCAATGGAGGCTGGTGACGG + Intergenic
936021769 2:109000614-109000636 TTCCAGTTGGAAACTGGGGACGG + Intergenic
937173268 2:119899240-119899262 ATCCAGTTGGAGTGGGATTATGG + Intronic
938100567 2:128495235-128495257 ATCCAGATGGAGACTGATGGTGG - Intergenic
938282566 2:130074899-130074921 ATCGTGATGGACTCTGGTGACGG - Exonic
938333193 2:130463471-130463493 ATCGTGATGGACTCTGGTGACGG - Exonic
938356619 2:130657200-130657222 ATCGTGATGGACTCTGGTGACGG + Exonic
938433052 2:131264006-131264028 ATCGTGATGGACTCTGGTGACGG + Exonic
938477104 2:131626589-131626611 ATCGTGATGGACTCTGGTGATGG + Intergenic
938827613 2:135021339-135021361 AGCAGGTTTGAGTCTGGTGAGGG - Intronic
939885354 2:147675548-147675570 CTTCTGGTGGAGTCTGGTGAGGG + Intergenic
942682450 2:178491804-178491826 ATCTAGTTGGCTTCTGGTGAGGG + Intronic
946379296 2:219333834-219333856 ATCCTGTGGCAGTCTGGTTAGGG + Intergenic
946702793 2:222429297-222429319 ATTCAGTAGGAGGGTGGTGATGG + Intronic
946811658 2:223531551-223531573 ATCCAGTTGGTATCTGATGCAGG + Intergenic
948130793 2:235599332-235599354 GCCCAGGAGGAGTCTGGTGATGG + Intronic
1169534233 20:6520184-6520206 ATTCAGATGGAGTCTGATCAGGG + Intergenic
1169752348 20:9007168-9007190 ATGGATTTGGTGTCTGGTGAGGG - Intergenic
1169907145 20:10615758-10615780 AGCAGGTTGGGGTCTGGTGAGGG + Intronic
1170951910 20:20944536-20944558 TTCCACTTGGAGGCAGGTGAAGG - Intergenic
1174493580 20:50922311-50922333 TTACAGTTGGAGTCTGAAGAAGG - Intronic
1175752123 20:61505956-61505978 GTCCATTCGAAGTCTGGTGATGG + Intronic
1177879572 21:26675700-26675722 TTCTAGTTGGAGTCAGCTGAAGG - Intergenic
1178697110 21:34802809-34802831 ATCCAGTTGGTTTATGGTGAAGG - Intronic
1179284851 21:39968501-39968523 CTCAATTTGGTGTCTGGTGAGGG + Intergenic
1185046021 22:48529147-48529169 ATCAAGGTGGAGGCTGTTGAGGG + Intronic
1185311407 22:50157504-50157526 TTCCAGGTGGTGTCAGGTGAGGG + Intronic
951587880 3:24233848-24233870 ATGCTGTTGGAGACTGCTGAGGG + Intronic
951760350 3:26140728-26140750 ATAGATTTGGTGTCTGGTGAGGG - Intergenic
955440948 3:58955097-58955119 CTACAGTTGGACTCTGGTGATGG - Intronic
957200942 3:77135287-77135309 ATCAAGTTAGAATCTAGTGAAGG - Intronic
957873611 3:86116645-86116667 ATCCTGTTGGAGTCTGGGCCAGG + Intergenic
957917747 3:86708364-86708386 ATCCAGTTTTAGTCTGTTGCTGG + Intergenic
959600346 3:108175926-108175948 AGTCAGTTGTGGTCTGGTGAGGG - Intronic
961066079 3:123878628-123878650 ATCCTGGTGGAGGATGGTGATGG - Intronic
961558823 3:127714904-127714926 ATCCAGTTGGCGTATGGTAGCGG + Intronic
962123464 3:132589128-132589150 ATAGAGTTGGTGCCTGGTGAGGG - Intronic
963931665 3:151009994-151010016 ATCTATTTGGCTTCTGGTGAGGG + Intergenic
965979074 3:174664636-174664658 ATCCAGTCAGAGTGTTGTGATGG + Intronic
967279055 3:187804873-187804895 ATTCAGTGGGGGGCTGGTGAGGG - Intergenic
968778062 4:2557007-2557029 ATCCAGTAGGGGTCTTGGGATGG - Intronic
968904750 4:3446045-3446067 TGACAGTTGGACTCTGGTGAGGG - Exonic
970400361 4:15711633-15711655 ATCCACAAGGAGCCTGGTGAGGG - Intronic
971841849 4:31862597-31862619 AAGCAGTTGGAGTGTTGTGAGGG - Intergenic
973582392 4:52357163-52357185 ATCAAGGTGGTGGCTGGTGAGGG - Intergenic
974585642 4:63872828-63872850 ATCCAGTTGTAGTATTGAGAAGG + Intergenic
974685047 4:65216637-65216659 GTCCAGGTGGAGTCTCCTGAAGG + Intergenic
975263745 4:72336661-72336683 ATCCAGTTGGAGAGTGATGAGGG + Intronic
975974905 4:80083953-80083975 ACAGATTTGGAGTCTGGTGAGGG + Intronic
977974272 4:103245801-103245823 CTCCAGTTGGGGTCTGCTCATGG - Intergenic
978071877 4:104482867-104482889 ATCCAGTTGTGGTATGGTGTGGG + Intronic
979804127 4:124949726-124949748 ATGTGGTTGGAGTCTGGTGAGGG - Intergenic
980796985 4:137697738-137697760 ATCTGGTTGGCTTCTGGTGAGGG + Intergenic
981542606 4:145861285-145861307 ATACAGTTATAGTCTTGTGAGGG - Intronic
984609066 4:181817766-181817788 AGCAGGTTGGCGTCTGGTGAAGG - Intergenic
987745574 5:21967436-21967458 AACCACTTGGAGGCTGGGGAAGG + Intronic
988290864 5:29284163-29284185 AGGCAGTTGGAGTTTGGTTAAGG + Intergenic
989392429 5:40915210-40915232 ATCCAGTTGGAGTCTGGTGATGG - Intronic
990777060 5:59314707-59314729 TTCCAGATGGAATCTGCTGAGGG - Intronic
991558260 5:67920905-67920927 GCACAGTTGGATTCTGGTGAGGG - Intergenic
991765775 5:69977564-69977586 AACCACTTGGAGGCTGGGGAAGG + Intergenic
991781547 5:70140598-70140620 AACCACTTGGAGGCTGGGGAAGG - Intergenic
991845010 5:70852635-70852657 AACCACTTGGAGGCTGGGGAAGG + Intergenic
991873990 5:71140912-71140934 AACCACTTGGAGGCTGGGGAAGG - Intergenic
992546061 5:77815030-77815052 ATGCAGTTGCAGTCAGGTGGTGG - Intronic
993107059 5:83611442-83611464 ATAAAGGTGGATTCTGGTGAGGG + Intergenic
996114944 5:119607789-119607811 ATTAAATTGGAGTCTGGGGATGG - Intronic
996254187 5:121378255-121378277 ATCTACTTGGCTTCTGGTGAGGG - Intergenic
996471307 5:123864166-123864188 AACAAGTTGGAGTCTGGGGTAGG - Intergenic
998206967 5:140164658-140164680 ATCCACTCGGCTTCTGGTGAGGG - Intergenic
998438273 5:142132949-142132971 ATCCAGATTGAGGCTGATGAAGG + Intronic
998908753 5:146935322-146935344 GTAAACTTGGAGTCTGGTGAGGG - Intronic
998978955 5:147679269-147679291 ATGTAGTTGGAGGCTGGGGATGG - Intronic
1001012265 5:168109123-168109145 ATCCAGCTGCAGTGTGCTGAGGG - Intronic
1004735646 6:18403791-18403813 ATCTACTTGGCTTCTGGTGAAGG + Intronic
1006727018 6:36206849-36206871 TTACAGTTGGAGTCAGGGGAAGG - Intronic
1007966217 6:46005833-46005855 ATAGATTTGGTGTCTGGTGAGGG - Intronic
1011647068 6:89469794-89469816 ATGCAGTTTGAGTATGCTGAGGG - Intronic
1011890263 6:92150551-92150573 ATCTGGGTGGAGGCTGGTGATGG - Intergenic
1013298212 6:108779080-108779102 CACCAGTTGGAGTTTGGGGAAGG + Intergenic
1014935826 6:127383689-127383711 ATCTACTTGGCTTCTGGTGAGGG + Intergenic
1017583920 6:155898922-155898944 GTACATTTGGGGTCTGGTGAGGG - Intergenic
1017739593 6:157395097-157395119 ATCCAGGTGTGGGCTGGTGAGGG - Intronic
1020151297 7:5683973-5683995 ATCCAGTAGGGGTCTTGTGGCGG + Intronic
1020518216 7:9152400-9152422 ATGGATTTGGCGTCTGGTGAGGG + Intergenic
1020548812 7:9571746-9571768 ATCCAGGTGGTGGTTGGTGAAGG + Intergenic
1023339368 7:39203585-39203607 GTCCAGTAGGATTCTGGTAAAGG + Intronic
1024536260 7:50437103-50437125 ATGCAGCTGGTGTCTGCTGATGG - Intergenic
1027026719 7:74858066-74858088 ATCCTGTGGGACTCTGTTGATGG - Intergenic
1027061033 7:75086043-75086065 ATCCTGTGGGACTCTGTTGATGG + Intergenic
1028030656 7:85907865-85907887 ATCGATTTAGTGTCTGGTGAGGG - Intergenic
1030214687 7:107032296-107032318 ATCAGGTTGAGGTCTGGTGATGG - Intergenic
1031609529 7:123808787-123808809 ATAGATTTGGTGTCTGGTGAGGG + Intergenic
1031682730 7:124694535-124694557 ATCCACTTGACTTCTGGTGAGGG + Intergenic
1031694083 7:124827485-124827507 ACCCAGCTGGCGTCTGCTGAGGG + Intronic
1032524917 7:132572765-132572787 ATCAGGTGGGAGTCTGGGGAGGG + Intronic
1036564785 8:9929476-9929498 ATAGATTTGGTGTCTGGTGAGGG + Intergenic
1037024025 8:14009878-14009900 GTAGATTTGGAGTCTGGTGAGGG - Intergenic
1038165616 8:25082638-25082660 ATGAATTTGGTGTCTGGTGAGGG - Intergenic
1038470056 8:27807960-27807982 ATCAAGATGGTATCTGGTGAGGG - Intronic
1039478508 8:37854788-37854810 ATCTGGTGGGAGTCTGGTGAAGG - Intergenic
1042199905 8:66271317-66271339 AGCCAGTTGGAGGCTGGAGGCGG + Intergenic
1042625526 8:70752385-70752407 ATCTCGTTGGCTTCTGGTGAGGG + Intronic
1043138403 8:76557217-76557239 GTAGAGTTGGTGTCTGGTGAGGG - Intergenic
1043593582 8:81858336-81858358 ATTCTGGTGGACTCTGGTGAAGG + Intergenic
1046060043 8:109128265-109128287 GTACATTTGGAGTCTGGTGAGGG + Intergenic
1048331551 8:133474128-133474150 ATCCAGGTAGATTCTGGGGAAGG - Intronic
1050205746 9:3194647-3194669 CTCCAGCTGGTGTTTGGTGAGGG + Intergenic
1050213870 9:3298744-3298766 ATCAAGTTGGATTCTGCTGAGGG + Intronic
1050755756 9:9001257-9001279 ATCCCCTTGGAGCCTGGGGAAGG + Intronic
1053869968 9:42480710-42480732 GGCCAGTTGGTTTCTGGTGAGGG - Intergenic
1054086324 9:60748440-60748462 GGCCAGTTGGTTTCTGGTGAGGG + Intergenic
1054241589 9:62619678-62619700 GGCCAGTTGGTTTCTGGTGAGGG + Intergenic
1054555715 9:66654201-66654223 GGCCAGTTGGTTTCTGGTGAGGG + Intergenic
1055268055 9:74521361-74521383 ATCCTTTTGGATTATGGTGAAGG - Intronic
1055700361 9:78938440-78938462 ATACATTAGGTGTCTGGTGAGGG + Intergenic
1059591564 9:115668249-115668271 CTCCAGTTGGGGTCTGCTCATGG - Intergenic
1185737203 X:2502647-2502669 TTCCAGTAGGAGTCTGCTGGGGG - Intronic
1186394471 X:9194238-9194260 ATACTGCTGGTGTCTGGTGATGG - Intergenic
1186612573 X:11152662-11152684 ATCCACTTGGAGTTTGGAGAAGG - Intronic
1186633434 X:11376365-11376387 TTCCAGTTGGAGTCTGTCAAAGG + Intronic
1187255636 X:17639445-17639467 ATCTGGTTGGCTTCTGGTGAGGG + Intronic
1187733927 X:22285007-22285029 TTCCATTTGGAGCCTGGTGAGGG - Intergenic
1187780625 X:22818716-22818738 GTACATTTGGAGTCTGCTGACGG + Intergenic
1189859878 X:45261512-45261534 GTGTAGTTGGATTCTGGTGAGGG + Intergenic
1189911957 X:45818924-45818946 ATCCAGTTTGAGGCTGGACATGG - Intergenic
1191007383 X:55723996-55724018 ATGCAGGTGGAGTCTGATCAGGG + Intronic
1193215611 X:78860607-78860629 ATCCACTTGGCCTCTGGTGAGGG + Intergenic
1195918302 X:109957224-109957246 GCCCATTTGGTGTCTGGTGAGGG - Intergenic
1196023089 X:111010709-111010731 ATCTGCTTGGATTCTGGTGAGGG - Intronic
1196937668 X:120745603-120745625 ATCTGGTTGGCTTCTGGTGAGGG + Intergenic
1197230061 X:123994096-123994118 ATCTACTTGGCTTCTGGTGATGG + Intronic
1200870197 Y:8089492-8089514 ATCCAAAGGGGGTCTGGTGATGG - Intergenic