ID: 989400620

View in Genome Browser
Species Human (GRCh38)
Location 5:41004224-41004246
Sequence TTCCTTGGCCTGCCCCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989400620 Original CRISPR TTCCTTGGCCTGCCCCAGAC AGG (reversed) Intronic
900387298 1:2416501-2416523 GTCCTGGGTCTGCCACAGACGGG - Intergenic
900599250 1:3496117-3496139 ACCCTGGGTCTGCCCCAGACAGG + Intronic
900616928 1:3569624-3569646 TCCCTGTGCCTGCCCCAGGCCGG - Intronic
901300965 1:8199983-8200005 GATCTTGGCCTTCCCCAGACTGG + Intergenic
901319126 1:8329091-8329113 TTCCTTTGTTTGTCCCAGACGGG - Intronic
902778170 1:18687813-18687835 CTGCTTGGCCTTCCCCAGTCTGG + Intronic
903081992 1:20817922-20817944 CTCCTTGGCCTCCCAAAGACGGG + Intronic
903885084 1:26536404-26536426 ATCCTTGCCCTGCCCCACTCTGG - Intronic
904382877 1:30123388-30123410 GACCCTGGCCTGCCCAAGACTGG - Intergenic
905063446 1:35159443-35159465 TGCCTTGGCCTCCCACAGGCTGG + Intergenic
906032713 1:42733986-42734008 TTCCTTGGCCAGCTCCATTCTGG - Exonic
906238662 1:44228165-44228187 TTCCTACCCCTCCCCCAGACAGG + Intronic
906686925 1:47768932-47768954 CTCCTTGGCCTGTCTCAGGCTGG - Intronic
908551599 1:65214054-65214076 TTGCTAGGGCTGCCACAGACTGG - Intronic
910468884 1:87529355-87529377 TGCCTCGGCCAGCCCCAGAGAGG + Intergenic
912752840 1:112299687-112299709 TTCCTTTGTCTTCCCCACACTGG + Intergenic
913313956 1:117534368-117534390 GTCCTTGGTCTTCCCCTGACTGG + Intergenic
914255845 1:145960915-145960937 TTCAATGGCCTGACCCTGACCGG - Exonic
915015568 1:152730028-152730050 TTCCTTGGCCATCACCAGTCAGG + Intergenic
916792579 1:168136910-168136932 TTACTTGGCCTGCGCCCGCCCGG - Intronic
917167122 1:172124746-172124768 TTCCTAGGCCTGGCTCTGACAGG + Intronic
917660840 1:177175378-177175400 TTCCTTGGCATTGCCCAGGCTGG - Intronic
919207040 1:194431393-194431415 GGCCTTGGCCAGCCCCAGAGAGG + Intergenic
919910401 1:202107337-202107359 TGCCTTGGGCTGCCTCACACAGG - Intergenic
919920919 1:202165960-202165982 CTCCTGGGCCTGCCCCAGCAGGG - Intergenic
920117079 1:203628745-203628767 TTCCTGGGCCTGGCCCAGCCTGG - Intronic
920377289 1:205516000-205516022 AACCTTGCCCTGCCCCAGCCTGG - Intronic
921664272 1:217849238-217849260 TTCCTTGTCCTGCCTGAGCCAGG + Intronic
922216177 1:223522189-223522211 TTCCCTGGCCTACAGCAGACAGG + Intergenic
922970364 1:229730998-229731020 TTCCATGGCCTTCCGTAGACTGG - Intergenic
923669639 1:236029511-236029533 TCCCAGGGCCAGCCCCAGACCGG - Intronic
923975317 1:239255924-239255946 AGCCTTGGCCAGCCCCAGAGAGG + Intergenic
1062843045 10:686196-686218 TTCCTTGACCCTCCCCAGAATGG + Intronic
1063759422 10:9056687-9056709 GGCCTTGGCCAGCCCCAGAGTGG - Intergenic
1067942781 10:50670109-50670131 TTCCTTGGCCTGCCCTCCCCAGG + Intergenic
1068643436 10:59437214-59437236 TTCCTTGGCCTGCTTCAGAGTGG - Intergenic
1069800681 10:71079821-71079843 TTCTCTGGCCAGCCCCAGAGAGG - Intergenic
1069920007 10:71810698-71810720 CTCCTAGCCCTGCCCCAGTCTGG - Intronic
1070067790 10:73054974-73054996 TTCCTTGGCCTCCCAAACACTGG - Intronic
1070665038 10:78336720-78336742 TTCCCTGCCCTGCTCCAGCCTGG - Intergenic
1070864024 10:79695072-79695094 TTCCTTGGCCTGCCCTCCCCAGG + Intergenic
1071630921 10:87217298-87217320 TTCCTTGGCCTGCCCTCCCCAGG + Intergenic
1073457615 10:103647102-103647124 TATCTTGGCCTGCCACAGCCAGG - Intronic
1075555257 10:123426317-123426339 TTCCTCCACGTGCCCCAGACAGG - Intergenic
1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG + Intergenic
1076611703 10:131730081-131730103 CTCCTGGGCCTGCCACAGGCTGG + Intergenic
1077200193 11:1302904-1302926 TTCCGGGGCCTTCCTCAGACAGG + Intronic
1077297699 11:1833896-1833918 CTCCTTGCTCTGCCCCAGACTGG + Intronic
1077474551 11:2780215-2780237 GTCCTTGCCCTGCCACTGACTGG + Intronic
1078896313 11:15600270-15600292 TTCCTTGGCCTGAAACAGGCTGG - Intergenic
1081569712 11:44282036-44282058 TTCCTTGGCCTCCTCTAGTCTGG - Intronic
1083019409 11:59491691-59491713 TTCCTTGGCCTAACCCAGAATGG + Intergenic
1083731430 11:64654513-64654535 TTCCTGCCCCTGCCCCAGTCCGG + Intronic
1083886898 11:65577353-65577375 ATCCTTGGCCTTGCCCACACTGG + Intronic
1084225132 11:67711020-67711042 TGCCTTTGCCAGCCCCAGCCAGG - Intergenic
1084262951 11:67990862-67990884 TGCCTTTGCCAGCCCCAGCCAGG - Intergenic
1084359700 11:68661425-68661447 TGCCTTGGACTGTCCCAGATGGG + Intergenic
1084684759 11:70687004-70687026 TTCCAGGGCCTGACCCAGAGTGG - Intronic
1084715277 11:70869733-70869755 TTGATTGTCCTCCCCCAGACAGG + Intronic
1084810442 11:71608254-71608276 TGCCTTTGCCAGCCCCAGCCAGG + Intergenic
1087318811 11:96635769-96635791 GGCCTTGGCCAGCCCCAGAGAGG - Intergenic
1087404931 11:97718155-97718177 GGCCTTGGCCAGCCCCAGAGAGG + Intergenic
1089216061 11:116835427-116835449 TTTCCTGGCCCGCCTCAGACAGG + Intergenic
1089453174 11:118610689-118610711 TTCCTTGGCCTCCTTCAGGCGGG + Intronic
1089776775 11:120843223-120843245 TTCATTGCCATGCCCCAGGCAGG + Intronic
1090435929 11:126686261-126686283 TCCCAAGGCCTGCTCCAGACTGG + Intronic
1090860292 11:130647092-130647114 TCCCTGCTCCTGCCCCAGACAGG - Intergenic
1091738716 12:2944544-2944566 GTCCTTGGCATGCCCCTGGCTGG - Intergenic
1091857029 12:3748384-3748406 TCCCTTGGCCAGCCCCATCCAGG + Intronic
1095642733 12:44502914-44502936 AGCCTTGGCCAGCCCCAGAGAGG + Intergenic
1096480720 12:51939064-51939086 TTCCTTGGGAAGCCCCAGCCTGG - Intergenic
1096603185 12:52745143-52745165 GTCCTGGGCCTCCCTCAGACAGG - Intergenic
1097176344 12:57145590-57145612 CTGCTTCTCCTGCCCCAGACAGG - Intronic
1097547527 12:61023354-61023376 TGCCTTGGCCAGCCCCAGAGAGG - Intergenic
1100836726 12:98573410-98573432 TCCCTTGGCCTGCCCATGGCAGG - Intergenic
1101528747 12:105555910-105555932 CTGCTTGGCCTGGCCCAGCCGGG - Intergenic
1102069175 12:110003316-110003338 TCACCTGGCCTGCCCCAGGCTGG - Intronic
1102179781 12:110903702-110903724 TTCCCTGGCCTGCCTCATTCAGG - Intronic
1103447699 12:121004896-121004918 TGCCTTGGCCTGGTCCTGACTGG + Intronic
1103532248 12:121610574-121610596 TTCCCTTGCCTCCCCCAGCCTGG - Intergenic
1104603390 12:130169067-130169089 TCCCTTGGGCTCCCCCACACTGG - Intergenic
1104816362 12:131648228-131648250 TTACTTGCCCTTCCCAAGACTGG + Intergenic
1105806195 13:23953023-23953045 AGCCTTGGCCAGCCCCAGAGAGG + Intergenic
1105846854 13:24300804-24300826 GTCCTTGGTTTGCCTCAGACTGG - Intronic
1106453435 13:29905903-29905925 TAACTTGGCCTTCCCCACACAGG + Intergenic
1106777012 13:33017791-33017813 TTCCCTGCCCTGCCGCAGAAGGG - Intronic
1108502833 13:51084117-51084139 TTCCTTGACGTGTCTCAGACTGG - Intergenic
1108817759 13:54313017-54313039 GGCCTTGGCCAGCCCCAGAGAGG - Intergenic
1112489625 13:99849821-99849843 TGCCTTGCCCTGGCCCTGACTGG - Intronic
1113541669 13:111114692-111114714 TTCCTTGACCTTCCCCCGGCAGG + Intronic
1113655442 13:112065834-112065856 TTCCTTTGCATGACGCAGACCGG + Intergenic
1114319658 14:21536787-21536809 TGCCCTGGCCTGACCCACACAGG + Intronic
1114566313 14:23635742-23635764 GGCCTTGGCCAGCCCCAGAGAGG - Intronic
1114653141 14:24299470-24299492 GTCCCTGGCCTGACCCAGTCCGG + Intronic
1116084434 14:40217216-40217238 GTCCTCGGCCAGCCCCAGAGAGG + Intergenic
1116873565 14:50090430-50090452 TCCCTTGACCTCCCCCAAACAGG + Intronic
1118823081 14:69357796-69357818 CTCCTGGGTCTGACCCAGACGGG + Intergenic
1120030082 14:79631402-79631424 GGCCTTGGCCAGCCCCAGAGAGG - Intronic
1120200481 14:81533510-81533532 TTGCTTGGCCTGCGCCAAAGGGG - Intronic
1121089524 14:91171483-91171505 TCCATTGGCCACCCCCAGACGGG + Intronic
1121626730 14:95390600-95390622 CTCCTTGGCTTGCCCCACATTGG + Intergenic
1122153566 14:99737575-99737597 ATCCTGGGGCTGCCCCAGAGAGG + Intergenic
1122780182 14:104140168-104140190 CACCCTGCCCTGCCCCAGACAGG - Intronic
1123007912 14:105333304-105333326 TCCCCTGGCCTGCCCCAGGCGGG + Intronic
1129694786 15:77734570-77734592 TTCCCTGGCCTGTCCCCCACAGG + Intronic
1130402142 15:83567311-83567333 TCCCTTGCCCTGCACCACACTGG + Intronic
1130691279 15:86083598-86083620 TTCCATGGCTTACTCCAGACAGG - Intergenic
1132836967 16:1959010-1959032 CTCCCTGCCCTCCCCCAGACAGG + Intergenic
1133021877 16:2970351-2970373 GTCCTTGAGCTGCCCCAGGCGGG + Intronic
1133222225 16:4323661-4323683 TTCCCTGGCCTGCACCAGCCCGG - Intronic
1137448601 16:48549685-48549707 TCCCTTGCCCTGCACCAGGCTGG - Intronic
1138248249 16:55482993-55483015 TTCTTTGGACTGCCCCAGACAGG + Exonic
1138521595 16:57574480-57574502 TTCCATGGCCAGCCCAAGGCCGG - Intronic
1140034790 16:71363994-71364016 TTCCAGGGCCTACCCCAGATGGG - Intronic
1141432718 16:83979172-83979194 TTTCTTGGGATTCCCCAGACAGG + Intronic
1142119964 16:88382409-88382431 GCCCTGGGACTGCCCCAGACTGG - Intergenic
1142210312 16:88805468-88805490 TTCCATGCCCTGGCCCAGCCCGG + Exonic
1142414971 16:89936366-89936388 TTCCCTGGCCTCCCACAGAGCGG + Intergenic
1144726442 17:17504868-17504890 GTCCTCGACCTGCCCCAGTCAGG + Intergenic
1144784515 17:17824226-17824248 TTCCTGGGGCTGCCCTAGAAGGG - Intronic
1146320563 17:31843322-31843344 CTCCTTGGCCTGCCACACTCAGG + Intergenic
1146373485 17:32279845-32279867 TTCCTCCCCTTGCCCCAGACTGG + Intronic
1146944236 17:36863216-36863238 TTCCTTTCCATGCCCCAGAAAGG - Intergenic
1148317754 17:46718245-46718267 TTTCTTGTCATGCCACAGACTGG + Intronic
1151387284 17:73762783-73762805 TGCCTTGGCCTCCCCAAGGCTGG - Intergenic
1151396589 17:73826990-73827012 TTCCAGGGCCAGCCCCAGGCTGG + Intergenic
1151814150 17:76462941-76462963 CTCCTTGGTCTGCCCCAAATGGG + Intronic
1153332075 18:3883710-3883732 TTCCTTGGCCTTGCCCAGCCTGG - Intronic
1157334738 18:46729526-46729548 TCCCTTTGCCTGCCCCAGGAGGG - Intronic
1159346750 18:67215908-67215930 GGCCTTGGCCAGCCCCAGAGAGG + Intergenic
1160547403 18:79668972-79668994 TTGCCTGTCCAGCCCCAGACTGG + Intergenic
1162615476 19:11797637-11797659 TCCCTTTGCCGGCTCCAGACTGG - Intergenic
1162621488 19:11847821-11847843 TTCCTTTGCAGGCTCCAGACTGG - Intergenic
1162736238 19:12748608-12748630 CCCCTTGGCCAGCCCCAGGCTGG + Intergenic
1163304453 19:16469100-16469122 TTCCTTGCCATGCCCCAAAGTGG - Intronic
1163767405 19:19171141-19171163 ATCCCCTGCCTGCCCCAGACGGG - Intronic
1166068958 19:40376805-40376827 TCCCTAGGACTGCCCCACACAGG - Intronic
1166230894 19:41425438-41425460 CTCCTTGGCCTCCCCCAGCCAGG - Exonic
1166805309 19:45483400-45483422 TTCCTTGGCCTCCCAAAGGCTGG + Intergenic
1166826232 19:45611015-45611037 TTCCCTGATGTGCCCCAGACTGG - Intronic
1168550689 19:57290804-57290826 ATCCATGGCCTGCCCCAAATAGG - Exonic
926096840 2:10086827-10086849 TTCCTTGGCCTCCCAAAGTCAGG + Intergenic
926537386 2:14129677-14129699 TTCCTTGCCCTTCCCCATACAGG - Intergenic
927542504 2:23926247-23926269 GTCCTTGTCCTGCCCCAGAGGGG - Intronic
928793813 2:34991991-34992013 GGCCTTGGCCAGCCCCAGAGAGG - Intergenic
929562244 2:42963158-42963180 TTCAATGATCTGCCCCAGACAGG + Intergenic
930585219 2:53259916-53259938 GGCCTCGGCCAGCCCCAGACAGG + Intergenic
931534757 2:63262132-63262154 TTACTTGGACTGCCCTTGACTGG + Intronic
932087487 2:68775007-68775029 ATTCTTGGCCTGGCCCTGACCGG + Intronic
932118562 2:69077204-69077226 ACCCTTGGCCTGCTCCAGAGAGG + Intronic
932214801 2:69959638-69959660 GCCCTTGGGCTGCCCCACACAGG + Intergenic
936405130 2:112195991-112196013 TTCCTTGGCCTGGAAGAGACTGG - Intergenic
937886823 2:126905597-126905619 TTGTTTGGGCTGCTCCAGACTGG - Intergenic
938164801 2:129017318-129017340 TTCCTTGGCCTGCCCTACAGAGG + Intergenic
938558662 2:132450117-132450139 TTCCTTGACCTGCCAGAGCCTGG - Intronic
939666985 2:144964601-144964623 TTCCTGAACCTGCCCCAGCCAGG + Intergenic
940485624 2:154291717-154291739 CGCCTTGGCCAGCCCCAGAGAGG + Intronic
941422311 2:165297988-165298010 TTCATTGGCATTCCCAAGACTGG - Intronic
941625031 2:167822069-167822091 TTCCTTGGTCTGCCACTCACTGG - Intergenic
942903056 2:181145887-181145909 GGCCTTGGCCAGCCCCAGAGAGG + Intergenic
946027638 2:216681448-216681470 TTCAGTGGGCTGCCCCAGCCTGG + Intronic
946420115 2:219560233-219560255 TTCCTCCTCCTGCCCCAGAGTGG - Intronic
948248115 2:236503547-236503569 TTGCCTGGTCTCCCCCAGACAGG - Intronic
1169650746 20:7864629-7864651 TCCCTAGCCCTGCCCAAGACAGG - Intergenic
1170546419 20:17438844-17438866 TCCCTTGGCCTGGCCCACAGGGG - Intronic
1172609586 20:36240100-36240122 TTCCTTAGCCTGCACCAGCGGGG + Exonic
1173470694 20:43321176-43321198 TTGCAGGGGCTGCCCCAGACCGG + Intergenic
1173701187 20:45073374-45073396 TTCCTTGGCCTGCTTCAGGGAGG - Intronic
1175191164 20:57212938-57212960 GTCCCTGGCATCCCCCAGACGGG + Intronic
1179474576 21:41634992-41635014 TCACTTGGCTTGCCCCAGTCTGG + Intergenic
1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG + Intronic
1180618596 22:17145113-17145135 TTCCTGAGCTTGCTCCAGACTGG - Exonic
1181261539 22:21601672-21601694 TGCCTGGCCCTGCCCCAGGCTGG - Intronic
1181669685 22:24420340-24420362 TTCCCTGCCCAGCCCCAGGCAGG - Intronic
1182664904 22:31950815-31950837 TTGCCTGGCCTGCCCCAAGCTGG - Intronic
1183329983 22:37214163-37214185 TTCAGTGGCCTGGCTCAGACGGG - Intergenic
1183479071 22:38052953-38052975 TCCCTTTGCCTGCCTCAGCCTGG + Intergenic
1185344612 22:50305850-50305872 TTCCATGGTCTCCCCCAGAGGGG + Intronic
1185418568 22:50722596-50722618 TTGCTTGGCCTGCCCGAGAGAGG + Intergenic
950105859 3:10388019-10388041 ATCCTTGGCCTGGCCCGGAGGGG + Intronic
950223201 3:11212444-11212466 TTTCCAGGCCTGCCCCAGATGGG - Intronic
950487454 3:13281916-13281938 CCCCTTGTCCTGCCCCAGATGGG + Intergenic
951952908 3:28220850-28220872 CTCACTGGCCTGCCCCAGTCTGG + Intergenic
952707914 3:36399009-36399031 TACCTTGGCCTGACCCACATGGG + Intronic
952898990 3:38097306-38097328 TTCCTGAGCCAGCCCCAGGCAGG - Intronic
953947306 3:47160840-47160862 TCCCTGGGCCTGCCCCATAATGG + Intronic
954700828 3:52450112-52450134 AGCCTTGGCATTCCCCAGACAGG - Intergenic
955405078 3:58620799-58620821 GTCCTTGGCCTTCCCCAAGCTGG - Intronic
957018817 3:75101000-75101022 TTCCTGAGGCTGCCCCAGTCAGG + Intergenic
961501387 3:127338305-127338327 CACCTCTGCCTGCCCCAGACCGG - Intergenic
961918198 3:130399143-130399165 TTCCTTGGTGTAGCCCAGACTGG + Intronic
964382213 3:156109056-156109078 TTTCTTTGCCTGCACCAGACGGG + Intronic
965637870 3:170802528-170802550 TTCCTTCTCCTGCCCCTAACTGG + Intronic
965733043 3:171792572-171792594 TTCCCTGCCCAGCCCCAGACTGG + Intronic
968930837 4:3577773-3577795 TTCCTTGGGCTGCCCCTCTCTGG - Intronic
969021460 4:4142778-4142800 TGCCTTTGCCAGCCCCAGCCAGG - Intergenic
969732404 4:8964638-8964660 TGCCTTTGCCAGCCCCAGCCAGG + Intergenic
969791986 4:9498721-9498743 TGCCTTTGCCAGCCCCAGCCAGG + Intergenic
971798533 4:31259253-31259275 AGCCTTGGCCAGCCCCAGAGAGG - Intergenic
976009247 4:80467530-80467552 TTCCTTGCCTTGCCCCAACCTGG + Intronic
976502559 4:85808514-85808536 TTCCTTAGCCTGTCCCAGGGAGG + Intronic
978835326 4:113142562-113142584 TTCCTTGGCCTGTCCCTGTTTGG + Intronic
982129899 4:152219136-152219158 TTGCTTGTTCTGGCCCAGACTGG - Intergenic
982600544 4:157443641-157443663 TTCCTTGCTCTTCCCCAGGCAGG - Intergenic
983660688 4:170128020-170128042 GGCCTTGGCCTGCCCCAGAGAGG + Intergenic
984891610 4:184498868-184498890 CTCCTAGGGCTGCCCCAGCCTGG + Intergenic
985073678 4:186191889-186191911 TTCCCTGGCCGGCGCCAGTCTGG + Exonic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
986276413 5:6279054-6279076 TTCCTTGCCATGACCCAGCCAGG - Intergenic
986348829 5:6858548-6858570 TTCCTTGGCCTCCGCCAGGGTGG + Intergenic
986506518 5:8457745-8457767 GTCCTTGGCCTGCGCCACCCAGG + Intergenic
988008653 5:25453670-25453692 TTCCTTGGTCAGACCTAGACTGG + Intergenic
988591438 5:32553188-32553210 GGCCTTGGCCAGCCCCAGAGAGG + Intronic
988605243 5:32673509-32673531 GGCCTTGGCCAGCCCCAGAGAGG + Intergenic
989400620 5:41004224-41004246 TTCCTTGGCCTGCCCCAGACAGG - Intronic
998039632 5:138944178-138944200 TTGCCCTGCCTGCCCCAGACTGG + Intergenic
998074129 5:139222426-139222448 TTAATTGGGCTGCTCCAGACAGG + Intronic
999114630 5:149151807-149151829 TTCCTGGGCCTGTCCAACACAGG + Intronic
1001175091 5:169460999-169461021 TTCCCTGCCTTACCCCAGACAGG + Intergenic
1002031867 5:176435754-176435776 CTACATGTCCTGCCCCAGACTGG + Intergenic
1002070609 5:176677100-176677122 TTCATGGACCTGCCCCAGAGAGG + Intergenic
1002296343 5:178233138-178233160 CTCCTTGGTCAGCCCCAGAAGGG - Intergenic
1002958380 6:1891137-1891159 TTCCTGTGCCTCCCCCACACAGG + Intronic
1006415091 6:33898959-33898981 TTCCTTGGACTCCCGCAGGCAGG + Intergenic
1006455180 6:34127785-34127807 TTCCTTGGCCTGGTCAAGATGGG + Intronic
1007246533 6:40467324-40467346 CAGCTGGGCCTGCCCCAGACAGG - Intronic
1007511910 6:42380387-42380409 CTCATTGGCATGCCCCACACAGG - Intronic
1007664947 6:43508573-43508595 TTCCTCTGCCTGCCCCAGCCTGG + Intronic
1011825780 6:91303547-91303569 GGCCTTGGCCAGCCCCAGAGAGG + Intergenic
1012016926 6:93864571-93864593 TTCCTTAGCTTTCCCCAGCCAGG + Intergenic
1012844489 6:104372631-104372653 TTCCTTTTCCTCCCCTAGACTGG - Intergenic
1017017830 6:150116050-150116072 GGCCTTGGCCAGCCCCAGAGAGG + Intergenic
1018874070 6:167804556-167804578 GTCCTTGCCCTGCCCCATGCAGG + Intergenic
1019666647 7:2255239-2255261 TTCCTTCGCCTGCCAGTGACAGG + Intronic
1020613394 7:10428571-10428593 GTCCTTGGTCTGCCTTAGACAGG + Intergenic
1022838108 7:34136118-34136140 TTCCTGGGCCAGCCCCAGTTTGG - Intronic
1023181757 7:37492043-37492065 AGCCTTGGCCAGCCCCAGAGAGG - Intergenic
1024254016 7:47526547-47526569 GTCCTGGCCCTGCCCCTGACAGG - Intronic
1026260251 7:68748671-68748693 TTCCTTTTCCAGACCCAGACTGG - Intergenic
1026605234 7:71810286-71810308 TGCATTGGCCTGTCCCGGACCGG + Intronic
1031101510 7:117486452-117486474 TTCCTTGACCAGCCTTAGACTGG - Intronic
1032176414 7:129631603-129631625 TTCCTTGGACTTCCTCAGCCTGG + Intronic
1033141783 7:138833794-138833816 TTCCCTTGCCTCCCCCACACTGG + Intronic
1033254536 7:139788767-139788789 AGGGTTGGCCTGCCCCAGACTGG + Intronic
1036280208 8:7393811-7393833 TTCCTTGGCCTGGCTCATCCTGG - Intergenic
1036341317 8:7918072-7918094 TTCCTTGGCCTGGCTCATCCTGG + Intergenic
1037469468 8:19193406-19193428 TTCCTTGGCTTGCCGGAGCCTGG + Intergenic
1037992094 8:23328374-23328396 TTCCTTACCTTGCCCCAGTCGGG + Exonic
1038458040 8:27691226-27691248 TTCCTAGGCTTTCCCCAAACTGG - Intergenic
1038537063 8:28360945-28360967 TTCCTTGGGCTGCTCCTGGCAGG + Exonic
1041691659 8:60693519-60693541 AACCTTGCCCTGCCCAAGACAGG - Intronic
1047248948 8:123167183-123167205 TTCCATGGACTGGCCCAGAGTGG + Intergenic
1050676000 9:8053681-8053703 TGCCCTGGACTGCCCCTGACCGG - Intergenic
1050898227 9:10910891-10910913 GGCCTTGGCCAGCCCCAGAGAGG - Intergenic
1053169005 9:35865075-35865097 TTCCTCGGCCTGCCCCAGGAGGG + Intergenic
1056803662 9:89711652-89711674 ATCCCTGGCCTGCCACAGCCTGG - Intergenic
1058065162 9:100540544-100540566 GGCCTTGGCCAGCCCCAGAGAGG + Intronic
1060781687 9:126417811-126417833 TTCCTGGGCTTGCCCCAGACTGG - Intronic
1061055532 9:128220531-128220553 TTCCCTGGCAGGTCCCAGACAGG - Intronic
1061950852 9:133935103-133935125 ACCCTTGGCCTGCCCAGGACGGG - Intronic
1062082144 9:134629819-134629841 GGCCTGGGCCAGCCCCAGACAGG - Intergenic
1186101778 X:6165076-6165098 TTCCTCTGCCCTCCCCAGACAGG + Intronic
1189229786 X:39443318-39443340 TTCCTTGCCCTTCCCCCAACAGG - Intergenic
1190283475 X:48946716-48946738 GTCATGGGCCTGCCCCAGCCAGG + Intronic
1199097234 X:143757623-143757645 GGCCTTGGCCAGCCCCAGAGAGG + Intergenic
1201266645 Y:12213269-12213291 TTCCTTTTCCTGCCCTGGACAGG + Intergenic
1201509744 Y:14745995-14746017 ATCCTTGGACAGCCACAGACAGG + Intronic