ID: 989404173

View in Genome Browser
Species Human (GRCh38)
Location 5:41042063-41042085
Sequence AAGAGGAAATTGAGAGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 762
Summary {0: 1, 1: 0, 2: 4, 3: 74, 4: 683}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989404173 Original CRISPR AAGAGGAAATTGAGAGCAAG GGG Intronic
900029438 1:360142-360164 AAGAGGAAATTGTGTCCATGTGG - Intergenic
900050040 1:588914-588936 AAGAGGAAATTGTGTCCATGTGG - Intergenic
900377522 1:2362973-2362995 CAGAGGAAAATGAGAGCAGATGG + Intronic
900576150 1:3383403-3383425 ACAAGGAGACTGAGAGCAAGTGG + Intronic
901435382 1:9244455-9244477 AAGAGGCAAGTGAGAGGAGGTGG + Intronic
902439779 1:16421764-16421786 ATGGGGAAATTGAGACCCAGCGG + Intronic
902776801 1:18680084-18680106 ATGAGGAAATTGAGGCCCAGAGG + Intronic
902924128 1:19684511-19684533 CGGAGGAAGTTGAGAGCCAGAGG - Intronic
903054591 1:20626783-20626805 AAGGGGAAGCTGAGAGGAAGGGG - Intergenic
903561850 1:24233948-24233970 AGCAGGAAAAAGAGAGCAAGGGG + Intergenic
903804165 1:25992277-25992299 ATGAGGAAGTTGAGAGGCAGGGG + Intronic
903867312 1:26409363-26409385 AAGATTGAATTCAGAGCAAGCGG + Intergenic
903935843 1:26894300-26894322 AGGAGGAGATTGAGCTCAAGTGG - Exonic
904098061 1:27997522-27997544 AAGAGGAATTGGACAGCAAGGGG - Intronic
904808586 1:33148842-33148864 ATGAGGAAACTGAGACCCAGAGG + Intronic
904850255 1:33454016-33454038 AAGAGGTACCTTAGAGCAAGTGG + Intergenic
905229275 1:36504000-36504022 AAGAGGATAGAGAGAGAAAGAGG - Intergenic
905316151 1:37082677-37082699 AAGAGGAGATGGAGGGCAAAGGG + Intergenic
905425860 1:37884035-37884057 AAGAGGAAAAAAAGACCAAGTGG + Intronic
905698068 1:39990581-39990603 GTGAGGAAGTTGAGACCAAGAGG - Intergenic
905771157 1:40638839-40638861 AAGAGGAAACTGAGGCCCAGCGG + Intronic
906717002 1:47977824-47977846 AAGAGGAAATGAAGAGCTGGAGG + Intronic
906822935 1:48948296-48948318 AAGAGCAAAGGGAGAGCAGGAGG - Intronic
907172442 1:52481298-52481320 ATGAGGAAAATGAGGCCAAGAGG + Intronic
907630601 1:56077492-56077514 ATGTGGAAAATGAGAGCAAGAGG - Intergenic
907816039 1:57919126-57919148 TGGAGGAAATGGAGAGTAAGGGG - Intronic
908057128 1:60299773-60299795 GAGAGGAGGCTGAGAGCAAGGGG - Intergenic
908269660 1:62410744-62410766 AAGATGAAAGTGTAAGCAAGGGG + Intergenic
908586184 1:65572114-65572136 AAAAGGAAACTGAGGGCCAGAGG + Intronic
908731258 1:67228888-67228910 AAAAGGGAATTGAGAGGAAGTGG - Intronic
908982487 1:69975845-69975867 AAGAGGAGATTGACAGCACAAGG - Intronic
909200465 1:72685469-72685491 AAGGAGAAGTTGAGAGCAAAAGG - Intergenic
909307094 1:74095097-74095119 AAGAGGAAATAAAGAAGAAGAGG - Intronic
909507956 1:76416282-76416304 ATGAGGAAATAGAGAATAAGGGG + Intronic
909562964 1:77025681-77025703 AAGAAGAAAGTGAGAGAAGGGGG + Intronic
909780354 1:79538243-79538265 ATGAGGAAATTGAAATCAAGAGG + Intergenic
910861751 1:91748837-91748859 ATGAGGAAACTGAGACAAAGAGG - Intronic
910912302 1:92249757-92249779 AGGAGGAAATGTAGAGCAACTGG - Intronic
911263961 1:95721177-95721199 AAGTGGAAATTGAGATAAAGAGG + Intergenic
911536577 1:99107065-99107087 TAAATGAAATTAAGAGCAAGTGG + Intergenic
911827272 1:102503126-102503148 TAGAGGAAAGTGGAAGCAAGTGG + Intergenic
911897934 1:103462604-103462626 AAGAGGAAATTGAGGCTTAGAGG - Intergenic
912189553 1:107321942-107321964 AAGAGGAAATTGAGGCACAGAGG - Intronic
912718174 1:111997133-111997155 AGGAGGAAATGGAGAGAAATGGG - Intergenic
913000124 1:114572034-114572056 AAGAGGAAATTGATATGATGTGG - Intronic
913134272 1:115872922-115872944 AAAATGAAATTTAGGGCAAGGGG + Intergenic
913226956 1:116708831-116708853 AAGATGAAATTGTCAGCATGAGG - Intergenic
913401952 1:118445806-118445828 AAGAGGAAATGAAGAGCACCTGG + Intergenic
913405543 1:118486768-118486790 AAGAGGAATGAGAGAGAAAGAGG + Intergenic
913594052 1:120356382-120356404 ATGAGGGAATGGAGAGCAGGTGG + Intergenic
914093204 1:144522608-144522630 ATGAGGGAATGGAGAGCAGGTGG - Intergenic
914305320 1:146411280-146411302 ATGAGGGAATGGAGAGCAGGTGG + Intergenic
914596737 1:149161532-149161554 ATGAGGGAATGGAGAGCAGGTGG - Intergenic
914696804 1:150090342-150090364 AAGAGGAAGGGGAGAGAAAGGGG - Intronic
914910709 1:151783690-151783712 AAGAGGAAACCAAGAGAAAGAGG - Intronic
914939297 1:152007847-152007869 CAGAGGAAATTGTGTGCTAGGGG - Intergenic
915014102 1:152717340-152717362 AAGAGAAAACTGAGACCCAGAGG - Intergenic
915420555 1:155778036-155778058 AAGAGGAATTTTAGAGGAATGGG - Intronic
915629659 1:157142471-157142493 AAAAGGGAAATGAGAGGAAGGGG - Intergenic
915907039 1:159886528-159886550 AGGAGGAACTGGAGAGGAAGAGG - Exonic
916290137 1:163156782-163156804 AAAATGAAATTGAGATTAAGGGG - Intronic
916867284 1:168873981-168874003 CAGAGGAAAATAAGAGGAAGGGG + Intergenic
916945885 1:169727100-169727122 AAGGGGAAATGGAAAACAAGAGG - Intronic
917138320 1:171809256-171809278 AAGAGCCTATTGAGAGAAAGGGG - Intronic
917208048 1:172598605-172598627 AAGAGAAAATACAGAGGAAGGGG - Intronic
917209419 1:172616374-172616396 AAGAGGAAATAAAGGGAAAGAGG - Intergenic
917333619 1:173907173-173907195 AAGAAGAAATTTACAGCATGAGG - Intronic
918491693 1:185088319-185088341 AACAGGAGATTGAGAGAGAGGGG + Intronic
918626093 1:186657637-186657659 AACAGGAAATTCAGTGCATGTGG - Intergenic
920344912 1:205300074-205300096 AAAAGGAACTTGATAGCAAATGG - Intergenic
920543663 1:206798119-206798141 AAGAGGAACTAGGCAGCAAGAGG - Intergenic
920589692 1:207205145-207205167 AAGAGGAAGCGGAAAGCAAGTGG - Intergenic
920624505 1:207583465-207583487 AAGAGGGAAATGACAGCAAGAGG + Intronic
921186142 1:212671208-212671230 AGGAGGAAATTGAGACCTAGAGG + Intergenic
921315622 1:213887644-213887666 AAGAGGAACGTGAGAGTAAAAGG + Intergenic
921383432 1:214547830-214547852 AAGAGGAAATTGAGAGGTGGGGG - Intronic
921608401 1:217181807-217181829 AAGAGCAAAAAGAAAGCAAGTGG + Intergenic
922190893 1:223317433-223317455 TAGAGTAAAGTGAAAGCAAGAGG - Intronic
922457441 1:225786708-225786730 ATGAGGAAATTGAGACCAGAAGG - Intronic
922478896 1:225924863-225924885 AAAAGGCAAGTGACAGCAAGGGG - Intergenic
924317442 1:242813163-242813185 AAATGGAAATTGAAAGCAAGAGG - Intergenic
1063438035 10:6050314-6050336 ATGAGGAAACTGAGACCATGAGG - Intronic
1063884280 10:10561915-10561937 AAGGAGAAAGTGAGAGCAGGGGG - Intergenic
1064063254 10:12157881-12157903 AAAAGGAAACGGAGAGTAAGTGG - Intronic
1064649208 10:17491189-17491211 AAGAAGAAACTCAAAGCAAGGGG + Intergenic
1064857516 10:19786643-19786665 AATAGGAAAATAAGAGCAAAAGG - Intronic
1064882499 10:20071864-20071886 AAGAGGCAGTTGAGAAGAAGTGG + Intronic
1065177647 10:23095309-23095331 AAGGGGAAAAGGAGAGGAAGAGG + Intergenic
1065298676 10:24301192-24301214 AAGAGAAATGTGAGAGCAGGGGG - Intronic
1065337662 10:24671113-24671135 AAGAGGAAAGTGAGAACATGGGG - Intronic
1066576738 10:36834049-36834071 GAGAGGAAATTAAGAGAAAGTGG + Intergenic
1067789772 10:49278882-49278904 AGGAGGAATTTGAGCACAAGGGG + Intergenic
1067975685 10:51022492-51022514 AAGAGGAAGTGGAGAGAGAGGGG - Intronic
1068119568 10:52772026-52772048 AAGAGGACATGGAGAGAAAGAGG - Intergenic
1068653409 10:59549008-59549030 AAGAGGAAACTGAGGCCCAGGGG - Intergenic
1068775330 10:60862671-60862693 AAGAGGAAGTAAAGAGAAAGAGG - Intergenic
1069211869 10:65771791-65771813 AAGAGGTAATTTGGATCAAGTGG + Intergenic
1070040182 10:72770442-72770464 AAGAGGAAATAGAGATAAATTGG - Intronic
1070458623 10:76642859-76642881 AAGGGGAAACTGAGGTCAAGAGG - Intergenic
1070717637 10:78734144-78734166 AAGAGGAGATAGACAGGAAGGGG - Intergenic
1071694837 10:87860960-87860982 AAAAGGAAATGGAAAGCAACCGG - Exonic
1071854618 10:89611236-89611258 AAAAGGCACTTGAGAGCAAATGG + Intronic
1072318389 10:94225179-94225201 AACAGGAAAATCAGAGCAACAGG - Intronic
1072544316 10:96422762-96422784 CAGAAGACATTCAGAGCAAGAGG + Intronic
1072705470 10:97677756-97677778 AAGGGGTAAATGAAAGCAAGAGG - Exonic
1072751907 10:97986860-97986882 AAGAGAAAAGTGAGAACAGGAGG - Intronic
1073425990 10:103455873-103455895 ATGAGGAAATGGAGGCCAAGAGG - Intronic
1073918808 10:108435385-108435407 AAGAGGAAAAAGGGAGGAAGGGG + Intergenic
1074078237 10:110148843-110148865 ATGAGGAAAGTGAGACTAAGTGG + Intergenic
1074249198 10:111727026-111727048 ATGAGGGGATTGAGATCAAGAGG - Intergenic
1074332411 10:112528783-112528805 CAGAGGAAATAGAAAGGAAGGGG + Intronic
1075263597 10:120982619-120982641 AAGAGAGAAATGAGAGAAAGAGG + Intergenic
1075467156 10:122660335-122660357 AAGAGGAGCTTGAGTGCAAAGGG - Intergenic
1075469206 10:122675530-122675552 AAGAGGAGCTTGAGTGCAAAGGG - Intergenic
1075529915 10:123220251-123220273 ATGAGGAAATTGAGGCCCAGAGG - Intergenic
1076269452 10:129138666-129138688 AGGGGCGAATTGAGAGCAAGTGG - Intergenic
1077201738 11:1310933-1310955 AAGAGGAAAGTGAGAGCACATGG - Intergenic
1077501033 11:2909781-2909803 AAGAGGAAACCGAGGCCAAGAGG - Intronic
1078274358 11:9828868-9828890 AAGAGTAATTGGAGAGGAAGTGG - Intronic
1078274370 11:9828958-9828980 AAGAGTAATTGGAGAGGAAGTGG - Intronic
1078589932 11:12631504-12631526 AAGAGGGAAGAGAGAGAAAGAGG + Intergenic
1079098362 11:17525800-17525822 ATGAGGAAATTGAGGCCCAGAGG - Intronic
1079412008 11:20197214-20197236 AAGATCAAATGGAGAGCAAGAGG - Intergenic
1079606894 11:22380878-22380900 GAGAGGAAATTGAGAAAAAAAGG - Intergenic
1080505093 11:32904556-32904578 AAGAGGTAAATGAGAGGATGTGG + Intronic
1080780329 11:35423416-35423438 AGGAGAAAACTGAGACCAAGAGG + Intergenic
1081157302 11:39710043-39710065 AAGAGGATTTTGACAGCATGTGG + Intergenic
1081541099 11:44035142-44035164 GGTAGGATATTGAGAGCAAGAGG - Intergenic
1081713747 11:45234185-45234207 GAGAGGAAACTGCGAGCAAATGG - Intronic
1081742037 11:45447727-45447749 AATAGGAAATGGAGGGCAGGAGG + Intergenic
1082001551 11:47395867-47395889 AAGAGGAAACTGAGGCCAAGTGG - Intergenic
1082087343 11:48060974-48060996 AAGAAGAGATTGAGATTAAGAGG - Intronic
1082102255 11:48182390-48182412 AATAGGCCATTGAGATCAAGGGG - Intergenic
1083569042 11:63746208-63746230 AAGAGGAAACTTAGAGAATGAGG - Intronic
1084664082 11:70566806-70566828 AACAGGAAATAGAGAGGAAATGG - Intronic
1084838103 11:71820555-71820577 AAGAGAAAGTTGAGAACAGGAGG - Intergenic
1084939387 11:72604252-72604274 TAGGGGAAAGTGAGAGGAAGTGG - Intronic
1084975743 11:72796894-72796916 AAGAGGAGTTTGAGACCAGGTGG - Intergenic
1085685080 11:78614155-78614177 AAAAGCAAATTGGAAGCAAGTGG - Intergenic
1086233877 11:84603416-84603438 ATGAGCAAATTGAGATCTAGAGG - Intronic
1086288931 11:85282596-85282618 AAGCGGAAAGTGAGTGAAAGGGG + Intronic
1086469051 11:87086898-87086920 AAGGGGAAATTGATAGCAGCAGG - Intronic
1086477853 11:87198602-87198624 AAGAGGAGATGGAAAGGAAGAGG - Intronic
1086575367 11:88333867-88333889 AAGATGAAATAGAGAGGAAGAGG - Intronic
1087016051 11:93555481-93555503 AAGTGGAAATTCAGAGGATGGGG - Intergenic
1087235694 11:95716052-95716074 AAGAAGAATTTTAGAACAAGTGG + Intergenic
1087329503 11:96762428-96762450 TAGAGGAGATAGAAAGCAAGTGG + Intergenic
1087761767 11:102110502-102110524 AAAAGGAAATAAAGAGAAAGGGG + Exonic
1089051369 11:115548890-115548912 AAGAGGAGATGGTGAGCCAGAGG + Intergenic
1089082754 11:115790850-115790872 AAGGGGAAATGGAGAGCATTGGG + Intergenic
1089189538 11:116644112-116644134 AGGTGGAAATTGAGAGAGAGAGG + Intergenic
1089664677 11:120010697-120010719 AAGAGAAAGTGGAGAGCAAGAGG - Intergenic
1089728165 11:120501290-120501312 AAAAGGAAATTCAAAGCCAGAGG - Intergenic
1089854719 11:121533040-121533062 AAAGGGAGATTGTGAGCAAGAGG + Intronic
1090175594 11:124646378-124646400 AAGGGGAAGTAGAGAGAAAGGGG + Intronic
1090414079 11:126528797-126528819 AAGAGGAGAGGGAGAGGAAGAGG + Intronic
1090416876 11:126546527-126546549 AAGATGAAATGGACAGAAAGCGG - Intronic
1090708706 11:129364941-129364963 AAGAGGAAACTGAGGAAAAGTGG - Intergenic
1090876584 11:130794272-130794294 AAGAAGAAATTGAGAGTCTGAGG + Intergenic
1090928584 11:131275124-131275146 AAGATAAAATTGAGACCCAGAGG + Intergenic
1091993841 12:4977445-4977467 AGGAGGAAAATGAGAGAAAATGG + Intergenic
1092124733 12:6067008-6067030 CAGAGGAAATTAGGAGAAAGTGG + Intronic
1092938086 12:13382625-13382647 AAGTGGAAAAAGTGAGCAAGAGG + Intronic
1093575917 12:20729774-20729796 AAGATGAAAGTGTGAGAAAGAGG + Intronic
1093722767 12:22463489-22463511 AAGGGCAAAAAGAGAGCAAGAGG - Intronic
1093773867 12:23049668-23049690 AAGAGTAAATTGAATGCAAGTGG - Intergenic
1094199728 12:27783203-27783225 AAGAGAAAATTAAGCGGAAGTGG + Intronic
1094479375 12:30869584-30869606 AAGAGGAAAATGATACAAAGTGG - Intergenic
1094605958 12:31949328-31949350 AGGAGGAAGTTGAGGGCCAGGGG + Intergenic
1094677956 12:32639516-32639538 AAAAGGAGTTTGAGAGGAAGGGG + Intronic
1095272548 12:40236724-40236746 AAGAGGAAGATGAGAGTATGAGG + Intronic
1095751209 12:45713245-45713267 AACAGGAAACTGGAAGCAAGGGG - Intergenic
1096621259 12:52867106-52867128 CAGATGACAGTGAGAGCAAGAGG - Intergenic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1097388111 12:58975007-58975029 AAGAGAAAATTCAGAGAAAATGG - Intergenic
1098307836 12:69119117-69119139 AAAAGGAGCTTGAGAGCGAGTGG - Intergenic
1098333547 12:69379356-69379378 AAGAGGAGATAGAGAGAGAGAGG - Intronic
1098676782 12:73299509-73299531 AAGAAGAAAATGAAAGGAAGGGG - Intergenic
1099254269 12:80296246-80296268 ATGAGGAAACTGAGATTAAGAGG - Intronic
1101497579 12:105269853-105269875 AAGAGGAAATTCATAACAAATGG + Intronic
1102048364 12:109844397-109844419 AAGATGAAACTGAGACCCAGAGG + Intergenic
1102275823 12:111581233-111581255 GTGAAGAAATTGAGACCAAGAGG - Intronic
1102351163 12:112193348-112193370 AAAAGGAAATCGAGAGGAATAGG + Intronic
1102415800 12:112761615-112761637 AATGGGAAATTGAATGCAAGAGG - Intronic
1102447819 12:113017079-113017101 ATGAGGAAATTGAGAGGTTGGGG - Intergenic
1102807034 12:115791291-115791313 CAGAGGAATTTGAGAGGAATGGG + Intergenic
1102831419 12:116004698-116004720 AAGGGGTCATTGAGAGGAAGGGG - Intronic
1103198186 12:119064609-119064631 AAGAGGAAAATGAGGTTAAGTGG - Intronic
1104574358 12:129953298-129953320 AGGAGGAAATTGAGACACAGAGG + Intergenic
1105325798 13:19369944-19369966 AAGAGAAAAATGAAAGCAGGAGG + Intergenic
1105677912 13:22694920-22694942 AAGAGGGAATGAAGAGTAAGAGG - Intergenic
1106564604 13:30873328-30873350 AAGAGGAACTTGTTAGGAAGTGG - Intergenic
1106956153 13:34941968-34941990 AAGAGGATATTGAGAGAAGGAGG + Intergenic
1107273162 13:38644334-38644356 AAGATGAAATTCATGGCAAGGGG - Intergenic
1107878463 13:44811790-44811812 AAGGAGAAAATGAGAGCAACTGG - Intergenic
1107886654 13:44879260-44879282 AAGAGGCAGGTGAGGGCAAGAGG + Intergenic
1108460231 13:50658566-50658588 ATGAGGAAACTGAGACCCAGAGG - Intronic
1108467059 13:50726925-50726947 AAGAGGAAAGTGGGGGCACGGGG + Intronic
1109996596 13:70135111-70135133 AAAAGGAAATTGAGGAAAAGTGG - Intergenic
1110311577 13:74056157-74056179 AGGAAGAAAGGGAGAGCAAGAGG + Intronic
1111639498 13:90948839-90948861 AAGAGGAAATAGAGAGATTGGGG + Intergenic
1112714035 13:102163457-102163479 TCGAGGAAGTTTAGAGCAAGTGG + Intronic
1113349644 13:109516323-109516345 TTGAGGGAACTGAGAGCAAGCGG - Intergenic
1114411915 14:22508970-22508992 AAGAGCAAATTCAGAGAAAAAGG + Intergenic
1114624388 14:24119356-24119378 CTGGGGAAATGGAGAGCAAGGGG - Intronic
1115406345 14:33021328-33021350 AAGAGGAAATTGAGACACAGAGG + Intronic
1115814799 14:37152357-37152379 AAAATGAAATTGAGAGTCAGTGG - Intronic
1116763027 14:49038352-49038374 AAGAGGAAATGGGTAGCTAGAGG + Intergenic
1118118749 14:62811586-62811608 TAGAAGAAAATGAGAGTAAGAGG + Intronic
1118460730 14:65984573-65984595 ATGAGGAAACTGAGTGCAAAAGG - Intronic
1119067345 14:71542273-71542295 AAGAGGAAGAGGAGAGGAAGAGG - Intronic
1119359098 14:74032926-74032948 GAGAGGGAAGTGAAAGCAAGAGG - Intronic
1120024213 14:79564277-79564299 AAGAGGGCATTGAGAGAAAGTGG + Intronic
1120573516 14:86151859-86151881 AGAAGGAAATTGAGAGGGAGAGG - Intergenic
1120599095 14:86478627-86478649 GTAAGGCAATTGAGAGCAAGAGG - Intergenic
1120695263 14:87637720-87637742 AAGAGTACATTGAAAGGAAGTGG - Intergenic
1121071082 14:91022160-91022182 ATGAGGAAATTAAAAGCAAATGG - Intronic
1122044754 14:99015665-99015687 AGGAGGAAATGGAAACCAAGAGG + Intergenic
1122437667 14:101710926-101710948 AAGAGGAAATTGGTACCAAGTGG + Intergenic
1122751331 14:103935720-103935742 AAAAGGAGACTGAGAACAAGTGG + Intronic
1123451307 15:20362390-20362412 AAGAGGAATCTGAGAACATGTGG + Intergenic
1123665095 15:22602723-22602745 AAAAGAAAATTCAGAGCATGTGG - Intergenic
1123736228 15:23186692-23186714 CAGAGGAGAATGACAGCAAGGGG + Intergenic
1123752665 15:23369930-23369952 AAAAGAAAATTCAGAGCATGTGG + Intergenic
1124143524 15:27098852-27098874 AAGAGGAAACCAAGAGCAAAGGG - Intronic
1124286934 15:28409665-28409687 CAGAGGAGAATGACAGCAAGGGG + Intergenic
1124295767 15:28501962-28501984 CAGAGGAGAATGACAGCAAGGGG - Intergenic
1124318927 15:28697145-28697167 AAAAGAAAATTCAGAGCATGTGG - Intergenic
1124870363 15:33535334-33535356 AAGAGGAAGAAAAGAGCAAGAGG - Intronic
1125010673 15:34870146-34870168 AACAGGAAAATGAGAAAAAGAGG - Intronic
1125114842 15:36078374-36078396 AAGAGGAAACTGAGACTAACAGG - Intergenic
1126369827 15:47933924-47933946 GAGAGGAAAATGGGAGAAAGAGG - Intergenic
1126648560 15:50898896-50898918 AAGAGGAATTTCAGTTCAAGAGG + Intergenic
1126820444 15:52497785-52497807 AAGAAGAAATTGAGGGCAGAAGG + Intronic
1127472453 15:59302463-59302485 ATGAGGAAAGTGAGACTAAGCGG - Intronic
1128637781 15:69314215-69314237 AAAAGGAAATTGTGTGCAGGAGG + Intronic
1128699654 15:69794912-69794934 ATGAGGAAAATGAAAGCACGGGG - Intergenic
1129258479 15:74348180-74348202 AAGAGGAAACTGAGACTCAGAGG - Intronic
1129782938 15:78286450-78286472 ATGAGGAAATTGAGAACCAACGG + Intronic
1129948298 15:79561164-79561186 AAAAGAAAATGGAGAGGAAGGGG - Intergenic
1130055641 15:80523191-80523213 GAGAGGAAATTAAGAGTAAAGGG + Intronic
1130907156 15:88248962-88248984 ATAAGGAAATTGAGACCCAGAGG + Intronic
1132037484 15:98498165-98498187 AACTGGAAATTAATAGCAAGAGG - Intronic
1132194666 15:99904000-99904022 AGGATGAAATTGGGAGCCAGTGG + Intergenic
1132471927 16:109423-109445 AAGAGGAAATTGAGGCTCAGTGG - Intronic
1133475440 16:6116891-6116913 AAGATGAAATTGGGAGACAGAGG + Intronic
1133485508 16:6215023-6215045 AAAAGGAAATGGAGAGGGAGAGG + Intronic
1134688990 16:16178681-16178703 AAGAGGAAATTGGACTCAAGTGG + Intronic
1135937253 16:26791853-26791875 AAGAGGAAATAGGAAGCAGGAGG + Intergenic
1135997933 16:27267407-27267429 ATGAGGAAACTGAGACTAAGAGG + Intronic
1136137158 16:28263475-28263497 CAAAGCAAATTGAGAGCAACAGG + Intergenic
1137456418 16:48621364-48621386 AAGAGGAAGCCAAGAGCAAGAGG + Intergenic
1137543676 16:49382781-49382803 AAGAGGAAAGAGATAGGAAGAGG - Intronic
1137766613 16:50982306-50982328 GACAAGGAATTGAGAGCAAGTGG + Intergenic
1137983064 16:53086001-53086023 AAAAGGAAATTGAGAGCTTTGGG + Intronic
1138073366 16:54016111-54016133 ATGAGAAAACTGAGACCAAGAGG + Intronic
1138215801 16:55204328-55204350 AGGAGGGAGTTGAGATCAAGAGG - Intergenic
1138459909 16:57142020-57142042 TACAGGAAATTGAGAGCAGGTGG + Intronic
1138754191 16:59462770-59462792 AAGAGAAAATTGAAAGCAAAAGG - Intergenic
1138878503 16:60981313-60981335 AAGAACAAATTGGTAGCAAGAGG - Intergenic
1138982685 16:62289368-62289390 AAGAAGAAATTGTAGGCAAGAGG - Intergenic
1139559180 16:67730824-67730846 AAAAGGAGAATGAGGGCAAGTGG - Intronic
1140639466 16:76955450-76955472 AAGAAGATATTCAGGGCAAGAGG - Intergenic
1141009673 16:80385812-80385834 ATGAGGAAACTGAGGCCAAGAGG + Intergenic
1143015987 17:3891613-3891635 AAGAGGCACCTGATAGCAAGAGG + Intronic
1143690582 17:8561036-8561058 TACAGGATATTGTGAGCAAGTGG - Intronic
1144537173 17:16102125-16102147 AAAAGGAAATTCACAGGAAGAGG - Intronic
1144664265 17:17091334-17091356 ATGAGGAAACTGAGACCCAGGGG + Intronic
1144862750 17:18315752-18315774 AAGAAAACATTGAGAGGAAGTGG - Exonic
1146588010 17:34099592-34099614 AAGAGAAAAAAGAGAGAAAGAGG + Intronic
1146703103 17:34979577-34979599 AATAGAAAATAGAGAGGAAGAGG - Intronic
1147217210 17:38907919-38907941 ATGAGGAAACTGAGACCCAGAGG + Intronic
1148681870 17:49478799-49478821 AAGAGGAAATGCAAAGGAAGAGG + Intergenic
1148741115 17:49893277-49893299 AAGAGGAAAGAAAGAGAAAGAGG + Intergenic
1148741116 17:49893294-49893316 AAGAGGAAAGAAAGAGAAAGAGG + Intergenic
1149224493 17:54453648-54453670 AAGGGGAAATTGAGAGCTGATGG + Intergenic
1149513252 17:57259369-57259391 AAGAGGAAATTGAGACCCAGAGG - Intronic
1149615091 17:57990248-57990270 AACAGGAAATAGAGGTCAAGTGG + Intronic
1150389997 17:64784593-64784615 AAGAGGAGACAGAGAGGAAGTGG + Intergenic
1150452003 17:65277069-65277091 ATGAGGAAATTGAGGTCCAGGGG - Intergenic
1151165902 17:72203679-72203701 AAGAGCAAATGGATAGGAAGAGG - Intergenic
1152056510 17:78032170-78032192 ACTAGGAAATTGAGAGAAAAGGG - Intronic
1152152177 17:78608982-78609004 GTGTGGAAATTGAGAGCGAGCGG + Intergenic
1152950319 17:83226414-83226436 AAGAGGAAATTGTGTCCATGTGG + Intergenic
1153001936 18:463783-463805 AAGTGGAAATTGGGGGCTAGGGG - Intronic
1153378311 18:4406752-4406774 AATAGTAAATGGAGAGAAAGAGG + Intronic
1153404457 18:4720749-4720771 AAAGGGAAGTTCAGAGCAAGGGG - Intergenic
1154219952 18:12443217-12443239 CAGAGGAACTTCAGAGGAAGGGG + Intergenic
1154484707 18:14864653-14864675 AAGAGGATGATGAGAGCAGGAGG - Intergenic
1155495213 18:26436031-26436053 AAGAGGGAATGGAGGTCAAGAGG - Intergenic
1156144331 18:34158196-34158218 AAAAGAAATTTGAGAGCAAGGGG + Intronic
1156472071 18:37383732-37383754 AAGAGGAAATAGAGACCCAAAGG + Intronic
1156487302 18:37474576-37474598 AAGAGGAAACTGAGGCAAAGGGG - Intronic
1156703529 18:39852975-39852997 AAGAGGAAAATTAGAGCCATAGG + Intergenic
1156712688 18:39965911-39965933 TAGAGGATATTGGGAGAAAGTGG + Intergenic
1156961853 18:43041891-43041913 AAGAGGAAAATTATAGAAAGGGG + Intronic
1157298583 18:46463280-46463302 AAGAGGAAAATAAGAGAAAAAGG - Intergenic
1157402400 18:47399575-47399597 GAGAAGACAATGAGAGCAAGTGG + Intergenic
1157406103 18:47423920-47423942 AGGAGGAAAGAGAGAGAAAGAGG + Intergenic
1157505772 18:48225355-48225377 AAGAGGAAAGGGAGAGGAAGAGG + Intronic
1157505777 18:48225372-48225394 AAGAGGAAAGGGAGAGGGAGAGG + Intronic
1157919141 18:51697835-51697857 AAGAAGATCTTGAGAGGAAGAGG - Intergenic
1158304498 18:56089790-56089812 AAGAGGGAAGTGAGAGTAAGAGG - Intergenic
1159084649 18:63774844-63774866 CAGAGAAAATTGAGAAAAAGAGG + Intronic
1159321315 18:66854230-66854252 AAAAGAAAATTGAAAGTAAGTGG - Intergenic
1159971302 18:74657874-74657896 AAGGAGAAGTAGAGAGCAAGAGG - Intronic
1160127969 18:76195980-76196002 AAGACGAAATGGAGAGAAAGAGG + Intergenic
1160308649 18:77767300-77767322 GATAGAAAAGTGAGAGCAAGGGG + Intergenic
1161856584 19:6769238-6769260 ATGAGGAAATTGAGGCCTAGAGG + Intergenic
1161911913 19:7200226-7200248 ATGAGGAAGTTGAGAGGCAGAGG + Intronic
1162455896 19:10784564-10784586 ATGAGCAAATGGAGAGGAAGGGG - Intronic
1163519986 19:17786444-17786466 ATGAGGAAATTGAGGTGAAGTGG + Intronic
1164144442 19:22503207-22503229 AAGATGGAGTTCAGAGCAAGAGG - Intronic
1164526361 19:29016300-29016322 AAGAGGAGAGAGAGAGGAAGAGG - Intergenic
1164717384 19:30403374-30403396 AGGAGGAAAGTGAGAGCCAAAGG + Intronic
1165817871 19:38653795-38653817 AAGAGGCAAGTGATAGCAAGTGG + Intronic
1165977297 19:39687425-39687447 AACAAGAAATTGGTAGCAAGAGG + Intergenic
1167136106 19:47616672-47616694 AAGAGGAAATTGTGGCCCAGTGG - Intronic
1168428926 19:56261594-56261616 AGGAGCAAATTGAGAGAGAGAGG + Intronic
1168566645 19:57430295-57430317 AAGAGCAAAGAGACAGCAAGAGG + Intronic
925602737 2:5625753-5625775 ATGAGGGAATGGAGAGCAGGTGG + Intergenic
925651251 2:6091891-6091913 AAGATGGAATTGAGAGAAGGAGG - Intergenic
926485670 2:13453904-13453926 AAGAGGAATCTGAGAACATGTGG - Intergenic
926821769 2:16859336-16859358 ATGAGGAAGTAGAGAGCTAGGGG - Intergenic
926911310 2:17853933-17853955 AGGAGAAAATTGAGATCCAGAGG - Intergenic
928085787 2:28345456-28345478 AGGAGGAAACTGAGATCAACTGG - Intergenic
928447752 2:31348094-31348116 ATGAGGAAACTGAGTTCAAGTGG + Intronic
928894646 2:36246688-36246710 AAGAGAAAATTGAGCTCATGAGG - Intergenic
929005372 2:37388316-37388338 AAGAGCAGATTCAAAGCAAGAGG - Intergenic
929041112 2:37745656-37745678 AAGAGGAAAATGAAAGCCAATGG - Intergenic
929489298 2:42382278-42382300 AAGAGGAAACAGAGAGAAAAGGG + Intronic
929967787 2:46548483-46548505 ATGAGGAAATTGGGAACAAGTGG + Intronic
930358808 2:50352234-50352256 AAGAGGAGAGTGAGTGGAAGAGG + Intronic
930723389 2:54659182-54659204 AAGAGGAAGAGGAGAGGAAGAGG + Exonic
930948127 2:57101287-57101309 AACTGGAAATTGATAACAAGAGG - Intergenic
931290729 2:60870791-60870813 AGTAGGAAATTGTGAGCAGGAGG - Intergenic
931468109 2:62509992-62510014 AAAAATAAATTGAGAGGAAGAGG + Intronic
932048081 2:68370216-68370238 AAGAGAAATTTGAGGGAAAGGGG + Intronic
932688606 2:73893841-73893863 AAGAGGAAGATGAGATGAAGGGG + Intronic
932753274 2:74386328-74386350 AAGAGGAAATTGAGGCATAGAGG - Intronic
932887421 2:75560453-75560475 AACAGGAAAGTGGGAGGAAGAGG + Intronic
932998545 2:76889820-76889842 AAGAAGAAAGAGAGAGAAAGAGG + Intronic
933301238 2:80543911-80543933 AAGAGGAGAAGGACAGCAAGGGG - Intronic
934110281 2:88735812-88735834 AAGAGGAAATGGAGAGCTGCAGG + Intronic
934576655 2:95405988-95406010 AGGAGAAAACTGAGAGCTAGGGG + Intronic
934638877 2:96014156-96014178 AGGAGAAAACTGAGAGCTAGGGG + Intergenic
934858406 2:97743224-97743246 AAGCGGAAGTGGAGAGCCAGAGG - Intergenic
935139536 2:100340438-100340460 ATGAGGAAACTGAGCACAAGGGG + Intergenic
935361207 2:102247525-102247547 AACAGGAAATTCAAAGCCAGAGG + Intergenic
935609791 2:105010077-105010099 AAAAGAAAAATGAGAACAAGTGG + Intergenic
935757396 2:106287034-106287056 AAGAGTAAAGAGAGAGGAAGGGG - Intergenic
936887442 2:117329825-117329847 CAGAGGAGATTGTGTGCAAGGGG - Intergenic
936913431 2:117615571-117615593 AGGGGGAAACTGAGAGCAATAGG + Intergenic
936974950 2:118209413-118209435 AGGAGGAAATAAAGAACAAGGGG + Intergenic
938234407 2:129692140-129692162 AAGAGGAAATGGAGATAAATTGG + Intergenic
939570793 2:143837500-143837522 AAGAGGAAATAGAGACAAAAAGG + Intergenic
939691172 2:145262732-145262754 AAGATCAAATGGAGAGCAAAGGG + Intergenic
939839614 2:147171188-147171210 ATGAGGAAATTGAGGTCCAGAGG + Intergenic
939916954 2:148058156-148058178 AAGAAGAAAGTAAGGGCAAGGGG - Intronic
940094036 2:149953261-149953283 AAGAGCAAGGAGAGAGCAAGAGG + Intergenic
940123166 2:150291540-150291562 ATGAAGAAATTGAGGCCAAGAGG + Intergenic
940950680 2:159669957-159669979 AAGAGGAAAGAAAGAGCAACAGG - Intergenic
941604994 2:167585560-167585582 TAGAGCAAATTGAGAACTAGTGG + Intergenic
942015277 2:171807153-171807175 AAGAAGAGATTTAGAGCAAGGGG + Intronic
942121844 2:172785801-172785823 AAGAAGAAGTGGAGAGAAAGGGG - Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
942529393 2:176892637-176892659 AAGAGGAAATGAAGTGCAAATGG + Intergenic
942570154 2:177305708-177305730 AAGAGAAAAGGGAGAGAAAGAGG - Intronic
942711011 2:178836469-178836491 AAGAGGTAAATGAGAGTAAAGGG + Intronic
943597769 2:189878582-189878604 AAGGGGAAATGGAGAGTCAGGGG - Intergenic
943717733 2:191170767-191170789 ATGAGGAAATTGAGGGTTAGAGG + Intergenic
943960112 2:194253852-194253874 CAGTGGTAATAGAGAGCAAGGGG + Intergenic
944868466 2:203885141-203885163 AGGAGGAAATGGAGACCCAGAGG - Intergenic
945186599 2:207146260-207146282 AAGAGAAAATGGAGAGAATGTGG - Intronic
946080563 2:217114974-217114996 AAGAGGGAATTTTGAGCAACTGG - Intergenic
946095173 2:217268442-217268464 AAGAGGGAGCTGAGATCAAGAGG - Intergenic
946218923 2:218209542-218209564 AAGAGGAGAGAGAGAGAAAGGGG - Intergenic
946290201 2:218738694-218738716 GTGAGGAAATTGACCGCAAGAGG + Exonic
946769332 2:223072430-223072452 ATGAGGAAATTTATAGGAAGAGG + Intronic
946899112 2:224355329-224355351 AAGAGGAAGAGGAGAACAAGAGG - Intergenic
947390450 2:229634334-229634356 AGGAGGAAATTGAGAGGCAGTGG + Intronic
947528889 2:230896141-230896163 AAAAGGAACTTGAGAGCATGGGG - Intergenic
948315011 2:237021691-237021713 AAAAGGAAATTTAGAACAAGTGG - Intergenic
1169060815 20:2659315-2659337 AAGAGGCAAAAGAGATCAAGAGG + Intronic
1169625284 20:7561019-7561041 AAGCTGAAATTTAGATCAAGTGG - Intergenic
1170280887 20:14647629-14647651 GAAATGAAATTGAGAGCTAGGGG - Intronic
1170383853 20:15794690-15794712 AGGAGCAAATTGATTGCAAGTGG + Intronic
1171501764 20:25599381-25599403 AAGAGGAAATTGAGAAATAAAGG + Intergenic
1172116424 20:32576043-32576065 GAGAGGGAATTGAGAGCAGTGGG + Intronic
1172215888 20:33235432-33235454 AGGAGGAAACTGAGATCCAGTGG - Intergenic
1172538813 20:35695358-35695380 AAGACAAAGATGAGAGCAAGTGG + Intronic
1172932584 20:38597007-38597029 AAGAGGAAATTGTGGGTAGGTGG + Intergenic
1173280655 20:41624177-41624199 GAGTGGAGATTGACAGCAAGAGG - Intergenic
1173370423 20:42429855-42429877 AAGAGGGAAAAGATAGCAAGGGG + Intronic
1173372038 20:42445224-42445246 ATGAGGAAATTGAGTGCAGAGGG - Intronic
1173804660 20:45916360-45916382 ATGAGGAAACTGAGATCCAGAGG - Intergenic
1174205889 20:48838725-48838747 CATAGGAAAATGACAGCAAGGGG + Intergenic
1174359313 20:50017956-50017978 AAGAGGAGAAAGAGAGAAAGAGG - Intergenic
1174917090 20:54664856-54664878 AGGAGGAAATTGAGAGAGGGGGG + Intergenic
1175009336 20:55719186-55719208 AGGAGGAGACTGAGAGCAAGGGG + Intergenic
1175173669 20:57096646-57096668 AAGAGGTAACAGAGAGGAAGGGG - Intergenic
1175387889 20:58608843-58608865 GAGAGGACGTTGAGAGCACGGGG - Intergenic
1175502106 20:59457875-59457897 ATGAGGAAACTGAGGGTAAGAGG + Intergenic
1175541975 20:59753709-59753731 ATAAGGAAATTGAGATCCAGAGG + Intronic
1177115956 21:17087679-17087701 AAGAAGAAAAGAAGAGCAAGAGG + Intergenic
1177273426 21:18877093-18877115 AAGAAGGAATAGAGAGAAAGGGG + Intergenic
1177406609 21:20676166-20676188 AAGAGGAAATAGTGAGAACGTGG - Intergenic
1177828395 21:26109114-26109136 AAGAGGAAGGTGACAGCAAAGGG + Intronic
1178662320 21:34518147-34518169 AAGAGGAAATGGAAAGAATGAGG - Exonic
1178901052 21:36598922-36598944 CAGAGAAAATTGAGGGGAAGAGG + Intergenic
1180510945 22:16088599-16088621 AAGAAAAAATTGAAAGCATGGGG - Intergenic
1181097436 22:20515300-20515322 ATGAGGAAAATGAGACCTAGAGG + Intronic
1181979200 22:26753952-26753974 AAGAGTAAATTGACAGAAATTGG + Intergenic
1182794918 22:32984919-32984941 ATGAGGAAACTGAGACCCAGAGG - Intronic
1182809209 22:33102027-33102049 AATGGGAAATGGAGAGAAAGAGG - Intergenic
1183787557 22:40039066-40039088 AAGTGGAAAATGAAAGCATGGGG - Exonic
1184354881 22:43973111-43973133 AAGAGGAAATCTACAGCATGTGG - Intronic
1184592947 22:45497512-45497534 AAAAGGAAACTGAAAGAAAGTGG - Intergenic
1203293378 22_KI270736v1_random:17227-17249 AAGAGGAAAATGAAAGCCAATGG - Intergenic
949816971 3:8068972-8068994 AAGAGTAAAATGAGAGGAACAGG - Intergenic
950045998 3:9949006-9949028 AAGAGGAAAATGAGACCTAGAGG + Intronic
950744467 3:15075621-15075643 AGGAGGAAATGGAGAGGAAGAGG - Exonic
950757270 3:15185702-15185724 AAGAGGCTATTGAAAGCAAGTGG - Intergenic
951027391 3:17844419-17844441 AAGAGGAACTTGGGAGCCAGTGG + Intronic
951304919 3:21047838-21047860 AAAAGGAATTTGAGGGGAAGAGG - Intergenic
952042168 3:29274100-29274122 CAGAGGAAATTGAGAAGATGAGG - Intergenic
952172111 3:30818518-30818540 AACATGAAATAGAGAACAAGGGG - Intronic
952581653 3:34840162-34840184 AAGAGGAAATGGAGATAATGTGG + Intergenic
952612164 3:35225140-35225162 AAGAGGTAAATGAAAGGAAGAGG - Intergenic
952940525 3:38440984-38441006 AAGAGGAAAGAGAGAGAGAGGGG - Intergenic
952989905 3:38822910-38822932 AAGAGGAGATTGAGTCAAAGGGG - Intergenic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
955220469 3:57019194-57019216 AAGAGGAACAAGAGAGCAAGGGG + Intronic
955486997 3:59445233-59445255 ATGTGGAAATTGAGATCCAGAGG + Intergenic
955806774 3:62744845-62744867 AAGTAGAAATTGAGAGACAGTGG - Intronic
955859025 3:63307182-63307204 ATGAGGAAATAGAGACCCAGAGG + Intronic
956907700 3:73783585-73783607 ATGAGGAAACTGAGGGCAAGTGG + Intergenic
957293801 3:78310820-78310842 AAGAGGAAAGGAAGAGAAAGAGG + Intergenic
957682678 3:83457918-83457940 TAGAGGAAGTTGAGAAAAAGTGG - Intergenic
958055405 3:88404574-88404596 AAGAGTAAATGGAGAGGAAAAGG - Intergenic
958516889 3:95127637-95127659 AAGGAGAAAATGAGAGAAAGGGG - Intergenic
958882285 3:99686574-99686596 AAGAGAACATTAGGAGCAAGTGG + Intronic
959487569 3:106944893-106944915 AAAAGGAAAATGAGTGCAAAAGG + Intergenic
960219688 3:115091203-115091225 AAGAGGAAACTGAGGCAAAGGGG - Intronic
960239547 3:115324456-115324478 AATAGAAAATTGAAAGAAAGTGG - Intergenic
960294705 3:115928810-115928832 GAAAGGAAATTGAGAGAAAATGG + Intronic
960488300 3:118279555-118279577 AAGAGGAAATGGAGAACTTGGGG - Intergenic
960512102 3:118562612-118562634 GAGAGTGAATAGAGAGCAAGGGG + Intergenic
961141278 3:124558709-124558731 ATGAAGAAATTGAGACAAAGAGG + Intronic
961310108 3:125991342-125991364 ATGAGGAAATTGAGGGCTGGAGG + Intergenic
961534583 3:127562160-127562182 AAGAGGAAACTGAGACCCAGAGG + Intergenic
961643720 3:128381275-128381297 AAGAGGAAATGGGAAGCAAGTGG + Intronic
961828947 3:129613405-129613427 AAGAGGAAATTGAGGTCCAGAGG - Intergenic
962201193 3:133402506-133402528 AAGAGGAAAGTGAGCCCATGTGG - Intronic
962227060 3:133622014-133622036 AAGAGGGAAAGGAGAGGAAGGGG + Intronic
962812368 3:138970780-138970802 AAGAGGCAAATGACAGCAACAGG - Intergenic
964174042 3:153804058-153804080 AAGGGGAAATTGATAGCATAAGG - Intergenic
964241465 3:154600187-154600209 AAGAGGTAATTTGGGGCAAGGGG - Intergenic
964738340 3:159939761-159939783 AAGAGGAAAATGAGGACAGGTGG - Intergenic
965193829 3:165568088-165568110 AACAGATAATTGAGATCAAGGGG + Intergenic
965835932 3:172852780-172852802 AACAGCAAAGGGAGAGCAAGAGG + Intergenic
966277531 3:178193150-178193172 AAAAAGAGATTGAGAGAAAGTGG + Intergenic
967295340 3:187958818-187958840 CACAGGAAAGTGAGAGGAAGTGG - Intergenic
967695815 3:192529330-192529352 ATGAGGAAATTGTGAGAAACTGG - Intronic
967972574 3:195010443-195010465 AGGAGGAAACTGAGACCTAGAGG + Intergenic
969327537 4:6452526-6452548 AAGAGGAAACTGAGGCCCAGAGG + Intronic
970415966 4:15857212-15857234 AAATGAAAATTTAGAGCAAGTGG - Intergenic
970460308 4:16268553-16268575 AAGAGGGAGTTGTGATCAAGAGG - Intergenic
970974236 4:22024590-22024612 AAGGGGAAACTGACAGAAAGGGG - Intergenic
971489212 4:27193209-27193231 AAGGAGAAATTGGGACCAAGAGG + Intergenic
972120892 4:35700939-35700961 AAGAGGAAAGTAAGACCATGAGG - Intergenic
972342872 4:38167711-38167733 AAGAGAAAAATGAGAGAAGGTGG - Intergenic
972411420 4:38799340-38799362 AAGAGGCAATTGAGACACAGAGG + Intronic
972549870 4:40121702-40121724 AAGAGGAAACTCAGAGCAGGCGG + Exonic
972674645 4:41248547-41248569 GAGAGGAAATTGACTGCAAAGGG + Intergenic
973048804 4:45569033-45569055 AGGAGGATAATGAGAGCAGGAGG + Intergenic
973721104 4:53724487-53724509 AAAAAGAATTTGAGAGAAAGAGG - Intronic
973961541 4:56115368-56115390 AGGAGGAAACTGAAACCAAGAGG - Intergenic
974083914 4:57239493-57239515 AATAGGAAAGGCAGAGCAAGTGG + Intergenic
974429794 4:61780860-61780882 AAGAGAAAAGTAAGAGCAACAGG - Intronic
974655603 4:64816301-64816323 AAGATCCAAGTGAGAGCAAGTGG - Intergenic
974779551 4:66535824-66535846 AAGAGGAAATAGAGAACCATAGG + Intergenic
974936378 4:68413630-68413652 AAAAGGAAGTGGAGAGGAAGGGG + Intergenic
975938642 4:79613185-79613207 GAGAGTAAATTGAAAACAAGGGG + Intergenic
975939160 4:79620448-79620470 AAGTGCAAAGAGAGAGCAAGAGG + Intergenic
976857568 4:89623062-89623084 AAGAGGAAATGGAAAGAAATAGG - Intergenic
977303348 4:95293795-95293817 ACAAGGAAATTGAGAGCAACGGG - Intronic
977308664 4:95356903-95356925 AAGAGGAAACTGGGCGCAACTGG + Intronic
978386502 4:108180757-108180779 AAGAGGAGATGAAGAGGAAGAGG + Intergenic
979720308 4:123891999-123892021 AAGGGTAAGATGAGAGCAAGAGG - Intergenic
980436968 4:132788987-132789009 AAGAAGAAAAAGAGAGAAAGAGG - Intergenic
980879387 4:138694096-138694118 AAGATGAAATTGAAAGCAAGAGG + Intergenic
980989864 4:139729992-139730014 TAGAGGAAATTGACAGGAAGAGG - Intronic
981054393 4:140345249-140345271 AGGCGGCAATTGGGAGCAAGGGG - Intronic
981087886 4:140702424-140702446 AAAAGGAAATTAAGAGCAGAAGG + Intronic
981831435 4:149006660-149006682 AAGATGAAATTGAAGGTAAGAGG + Intergenic
981904557 4:149906329-149906351 ATGAGGAAGTTGAGGCCAAGAGG - Intergenic
982080000 4:151780057-151780079 AAGAAAAAATTGAGAGCTAGTGG + Intergenic
982371968 4:154643408-154643430 GAAAGGCAATTGAGAGCTAGTGG + Intronic
982558087 4:156894657-156894679 AAGATAAAATTGACAGCATGAGG + Intronic
983433377 4:167679883-167679905 ATGAAGAAATTGAGAGGAAAGGG - Intergenic
984292532 4:177813452-177813474 AAGAGGAAATGGAAATTAAGAGG - Intronic
984393673 4:179168793-179168815 AAGAGTAAATTGTGGGCAGGTGG + Intergenic
984459222 4:180011814-180011836 AAGAGGAAATTGAGGACACCTGG - Intergenic
984632858 4:182078746-182078768 CAGAGGAAATAGAGAGAGAGAGG + Intergenic
985163359 4:187066553-187066575 GAGAGGAAATTGACCGCAAATGG - Intergenic
985630475 5:1011426-1011448 AAGAAGAAGGTGAGAGCCAGAGG - Intronic
986055821 5:4135857-4135879 ATGAGGACATTGAGGGGAAGAGG - Intergenic
986061414 5:4195157-4195179 AAAATGAAAATGAGAACAAGTGG + Intergenic
986121408 5:4839648-4839670 AAGAAGAAAAAAAGAGCAAGGGG + Intergenic
986404885 5:7415944-7415966 ATGGGGACATTGAGAGCCAGGGG + Intronic
986407166 5:7437505-7437527 ATGAGGAAACTGAGGACAAGTGG - Intronic
986763827 5:10904745-10904767 ATGAGGAAACTGAGACCCAGAGG - Intergenic
986901012 5:12433494-12433516 AAGAGGAAAATAAAAGAAAGAGG - Intergenic
987451153 5:18085523-18085545 AACAAGAAATTCTGAGCAAGAGG + Intergenic
987460244 5:18199751-18199773 AAGAGGAAATTAAGATCAGCTGG - Intergenic
987590344 5:19917313-19917335 AAGAAAAAATTGAGAACAGGAGG - Intronic
987684512 5:21179948-21179970 AAGAGGAAAGTCAGAAAAAGAGG - Intergenic
987978072 5:25042147-25042169 CTGAGGAAATGGAGAGCAACAGG - Intergenic
988087342 5:26488558-26488580 AAGAGAAAATTGAGAGCACATGG + Intergenic
988213329 5:28237890-28237912 AAAAGGAAAGAGAGAGAAAGAGG - Intergenic
988253125 5:28786340-28786362 AACAGGCAAGGGAGAGCAAGTGG - Intergenic
988452077 5:31353262-31353284 AAGAGGTTTTTGAGAGCAACAGG - Intergenic
988609361 5:32710775-32710797 ACGAGAAAGGTGAGAGCAAGCGG + Intronic
989200108 5:38754675-38754697 AAGTGGGAAATGAGAGAAAGAGG - Intergenic
989404173 5:41042063-41042085 AAGAGGAAATTGAGAGCAAGGGG + Intronic
989470464 5:41811462-41811484 AAGAGGCAATGTAGAGAAAGAGG + Intronic
989683211 5:44054210-44054232 TAAAGGAAATTGATCGCAAGGGG + Intergenic
989964197 5:50449890-50449912 AAGAGGAAACAGAGACAAAGAGG - Intergenic
989992627 5:50786074-50786096 AAGAGGCATTTGAGGTCAAGAGG - Intronic
990284074 5:54282390-54282412 AAGAGGGAAACAAGAGCAAGGGG - Intronic
990556682 5:56943353-56943375 AAGAATAAATTGAGGGCAGGAGG + Intronic
991422481 5:66455324-66455346 AAGAAGAAAAAGAGAGGAAGTGG - Intergenic
991534564 5:67653177-67653199 AAGTTGAAATAGAGAGCAAGTGG + Intergenic
992040584 5:72827004-72827026 GAGAGGAAATGGAGAGTAAAGGG + Intronic
992831471 5:80597391-80597413 AAGAGGAAATTCAGGCCAAATGG + Intergenic
993064532 5:83081196-83081218 AAGAGAAAATGGGGAGAAAGTGG - Intronic
994019558 5:95007106-95007128 AAGAGGAGAATGAGAAAAAGGGG + Intronic
994446980 5:99888506-99888528 AACAGGAGAGAGAGAGCAAGGGG - Intergenic
995155471 5:108907192-108907214 AAAAGGAAATGGAGAAAAAGGGG - Intronic
995372968 5:111440174-111440196 AAGAGGAAATGGAGAGGAAGAGG + Intronic
995374627 5:111460047-111460069 AAGAGGTGATTGATAGCAAGTGG + Intronic
995475720 5:112546346-112546368 ATGAGGAAACTGAGACCCAGAGG + Intergenic
995533378 5:113112414-113112436 AGGAGGAAAAAGAGAGAAAGGGG - Intronic
995707077 5:114997407-114997429 TAGAGGAAATTAGGAGCTAGTGG - Intergenic
995933567 5:117481853-117481875 ATGAGGAAACTGAGAGGTAGAGG + Intergenic
996814364 5:127558592-127558614 AGGAGGGAATAGAGAGCAATGGG - Intergenic
996907295 5:128615517-128615539 AAGGGGAATTAGAGAACAAGGGG + Intronic
996953646 5:129157831-129157853 AAGAGGAACTTGAGAACACCTGG - Intergenic
997039662 5:130236590-130236612 TAAAGGATATTGAGAGGAAGTGG + Intergenic
997250439 5:132384756-132384778 AAGAATAAATTGATAGGAAGGGG + Intronic
998671163 5:144355831-144355853 AAAAGGACATTCTGAGCAAGGGG - Intronic
998687490 5:144545985-144546007 AAGAGGAAATTCGTTGCAAGGGG - Intergenic
998856763 5:146401375-146401397 AAGAGCAAATGCAGATCAAGAGG + Intergenic
999130423 5:149278774-149278796 AAGAGGGAAGATAGAGCAAGTGG - Intronic
999172691 5:149608700-149608722 ATGAGAAAATAGAGAGCTAGAGG + Intronic
999264490 5:150257470-150257492 AAGAGGGAATTCAGCCCAAGAGG + Intronic
999379054 5:151107330-151107352 AGGAGGAAATTGAGACACAGAGG + Intronic
1000014063 5:157262156-157262178 ATGAGGCAATTTTGAGCAAGTGG + Intergenic
1000062638 5:157670779-157670801 AAGAGGGAAGTGAGACCCAGTGG + Intronic
1000173540 5:158727730-158727752 AATAGGAAAACGGGAGCAAGCGG - Intronic
1000405660 5:160885889-160885911 AAGAGTAATTTAGGAGCAAGAGG - Intergenic
1001603237 5:172942775-172942797 AAGAGGAACGTGAGACCGAGTGG + Intronic
1001949752 5:175808021-175808043 AAGAGGAAATAGAGAGCTGGGGG + Intronic
1002060102 5:176620887-176620909 AGGAGGAGTTTGAGACCAAGTGG + Intronic
1002744552 5:181460229-181460251 AAGAGGAAATTGTGTCCATGTGG + Intergenic
1003709196 6:8569868-8569890 AAAAGGAATTTTAAAGCAAGTGG + Intergenic
1003771322 6:9305415-9305437 AAGAGGACTTGGAGAGCTAGGGG - Intergenic
1003858491 6:10299917-10299939 AAGATGTAATTCAGAGCAAACGG + Intergenic
1003928005 6:10895471-10895493 AAGAGAAAGTGGAGAGGAAGGGG + Intronic
1004800212 6:19138346-19138368 AAGAGGAAACTCAAAGGAAGAGG + Intergenic
1004816604 6:19317925-19317947 AAGAGAAGAGTGAGAGCAAGAGG - Intergenic
1005506354 6:26472200-26472222 AAGAGGAAGTAGAAAGTAAGGGG + Intronic
1006180629 6:32151625-32151647 AAGAGGAAAGGAAGAGAAAGGGG + Intronic
1006485299 6:34334946-34334968 AAGAGGAAAGAGAGAGAAAGAGG + Intronic
1006736979 6:36280691-36280713 AAGAGGGAACTGAAAGCCAGTGG - Intronic
1007085117 6:39138433-39138455 AATAGGAAATTCTCAGCAAGTGG - Intergenic
1007397515 6:41586110-41586132 AAGAGGAAACTTAGAGCTTGGGG - Intronic
1008321196 6:50116254-50116276 ATGAGAAAACTGAGGGCAAGTGG + Intergenic
1008323606 6:50149323-50149345 GAGTGGAATTTGAGAGCAACAGG - Intergenic
1008351979 6:50502253-50502275 AACTGGAAATTGATACCAAGAGG + Intergenic
1008689024 6:53957005-53957027 AGGAGGTAATTGAGAGAATGAGG - Intronic
1008765741 6:54912025-54912047 AAGAAGAAAATGAGACAAAGAGG - Intronic
1009655409 6:66538901-66538923 AAAAGGAAAATGAGAGTCAGAGG - Intergenic
1010089907 6:71968472-71968494 ATGAGGAAATTTTGAACAAGGGG + Intronic
1010112851 6:72261640-72261662 AAGAGGAAAGAGAAAGAAAGAGG + Intronic
1010605315 6:77882511-77882533 AAGTGAAAATTGAGAGCAAAGGG - Intronic
1011355609 6:86469980-86470002 AAGAGGAAATTGGGGGCTATTGG + Intergenic
1011375662 6:86683412-86683434 AATTGGGCATTGAGAGCAAGGGG + Intergenic
1011767405 6:90637521-90637543 AAGAGAAAATAGAGAGGAAGGGG - Intergenic
1012163768 6:95922841-95922863 AAGAGGAGGATGAGAGCGAGGGG - Intergenic
1012243915 6:96904912-96904934 AAATGGGAATGGAGAGCAAGGGG - Intergenic
1012246343 6:96930406-96930428 ATGAGGAAAATGAGAGTTAGAGG - Intronic
1012504598 6:99930772-99930794 AAGAGGAAATTCAAACCAAAGGG - Intronic
1013325095 6:109037622-109037644 ATGAAGAAATTGAGAACCAGAGG + Intronic
1013718205 6:112989610-112989632 AAGAGGAATTTAAGAGCCAAAGG + Intergenic
1014022001 6:116602052-116602074 ATGAGGAAATTGAGAATCAGGGG - Intergenic
1014043093 6:116851706-116851728 AGCAGGAAAGAGAGAGCAAGTGG - Intergenic
1014184496 6:118419800-118419822 AATTGGAAATAGAGAGGAAGGGG - Intergenic
1014200227 6:118601125-118601147 ATGAGGAAAGTGAGACTAAGAGG - Intronic
1014270454 6:119330371-119330393 GAGAGGAAATGGAGATAAAGAGG - Intronic
1014284724 6:119484132-119484154 AAGAGGAAGATGTGAGCCAGAGG + Intergenic
1014411840 6:121134338-121134360 GAGAGAGAATGGAGAGCAAGAGG - Intronic
1014955612 6:127611587-127611609 AAGAGGAAATTCAGCGATAGAGG + Intergenic
1014963057 6:127711044-127711066 AAGAAGAAAGTGAGGGAAAGTGG - Intronic
1015036084 6:128656229-128656251 AAAAGGAAACGGAGACCAAGAGG - Intergenic
1015695758 6:135977699-135977721 AAGGAGAAAATGAGAGAAAGGGG + Intronic
1016397489 6:143641121-143641143 AAGGGCAAAGAGAGAGCAAGAGG + Intronic
1017752025 6:157496911-157496933 GAGAGGAAGAGGAGAGCAAGAGG - Intronic
1019227264 6:170523528-170523550 CAGAGGAAATTGAGATAAACAGG + Intergenic
1019249462 6:170733770-170733792 AAGAGGAAATTGTGTCCATGTGG + Intergenic
1019754824 7:2761257-2761279 AAGAGGAAACTGAGACCCAGAGG - Intronic
1019818562 7:3220375-3220397 CAGTGGAAATTTTGAGCAAGTGG + Intergenic
1019954273 7:4400964-4400986 AAGAGCAAGGTGAGAGAAAGTGG + Intergenic
1020528713 7:9300076-9300098 AAAAGAAAATTGAAAGCAATGGG + Intergenic
1020794144 7:12661366-12661388 AAGAGGAAATTGTTGGCAGGTGG - Intergenic
1020957526 7:14760490-14760512 AAGAAGAATTTGAGAATAAGGGG - Intronic
1021000602 7:15325930-15325952 AGGAGGAGAGGGAGAGCAAGAGG + Intronic
1021833360 7:24641179-24641201 AAAAGTCAATTTAGAGCAAGTGG - Intronic
1021851769 7:24815498-24815520 AGGAGGCAATTCAGAGCCAGAGG + Intronic
1022681115 7:32547095-32547117 AAGAGGAAGTTGGTATCAAGAGG + Intronic
1024035724 7:45506124-45506146 AAGAGGAACTGGAGAGGAAGAGG - Intergenic
1024035737 7:45506192-45506214 AAGAGGAACTGGACAGGAAGGGG - Intergenic
1024035763 7:45506311-45506333 AAGAGGAAATGGACAGGAAGGGG - Intergenic
1024035768 7:45506328-45506350 AAGAGGAACTAGAGAGGAAGAGG - Intergenic
1024035777 7:45506396-45506418 AAGAGGAATTGGAGAGGAAGAGG - Intergenic
1024035783 7:45506430-45506452 AAGAGGAACTGGAGAGGTAGGGG - Intergenic
1024316191 7:48019227-48019249 AAGAGGAGAGAGAGAGAAAGGGG + Intronic
1024428472 7:49258037-49258059 ATGAGGAAAATGAGAGAAAAGGG + Intergenic
1024482227 7:49875657-49875679 AGGAGGAAAGTGAGAGTCAGTGG - Intronic
1024719454 7:52118876-52118898 AAGAGGAAAGGGAGAGGGAGAGG - Intergenic
1025039520 7:55628986-55629008 AAGAAGAAATAGAGAACAGGGGG + Intergenic
1026188397 7:68102299-68102321 AAGAGGAAACTGGGTGCATGGGG + Intergenic
1026888223 7:73967020-73967042 GAGAGGCATTTGAGAGCCAGAGG + Intergenic
1027462002 7:78466048-78466070 AGGAGGATGTTAAGAGCAAGTGG - Intronic
1027709427 7:81580125-81580147 AAAAAGAAGTTGAGGGCAAGTGG - Intergenic
1027955194 7:84869787-84869809 AAGAGGAACTTGACAGTAAATGG + Intergenic
1027968914 7:85051466-85051488 CAGAGGCAATTGAGAGGAAATGG - Intronic
1028250188 7:88531164-88531186 AAGAGTAACTTAAGAGCAATTGG - Intergenic
1029914771 7:104198048-104198070 AGGATGAGAGTGAGAGCAAGAGG - Intronic
1030099339 7:105931358-105931380 AAGAGGAAGAAGAGAGGAAGGGG - Intronic
1030142028 7:106314553-106314575 AAGAGGAGATTGACAGAAAGGGG - Intergenic
1031357200 7:120801296-120801318 TAGAGGAAATTGGGAACAACAGG - Intronic
1032559018 7:132868928-132868950 AAGATGAAATGGACAACAAGAGG - Intronic
1032646843 7:133834336-133834358 AAAAGGAAGTGGAGAGGAAGGGG - Intronic
1033245547 7:139714074-139714096 ACGAGGGAGTGGAGAGCAAGTGG + Intronic
1033291210 7:140084337-140084359 AAAAGGCAAGTGAGAGCCAGGGG - Intergenic
1033636016 7:143211899-143211921 GAGAGGGAATAGAGAGAAAGTGG - Intergenic
1033645553 7:143300345-143300367 AACAGGAAAGTGAGAGCTGGTGG - Intronic
1033721470 7:144063445-144063467 AAGAGCAATTTGAGTGAAAGAGG + Intergenic
1034024677 7:147687737-147687759 AGGAGCAAATTAAGAGCATGAGG + Intronic
1034462993 7:151208769-151208791 AAGAGGAAACTGAGGCCCAGAGG - Intronic
1034569013 7:151940369-151940391 AAGAGGAAAAAGACAGAAAGTGG + Intergenic
1034957128 7:155341908-155341930 AAGAGGAAATTAAGGTCAAATGG - Intergenic
1035245805 7:157561367-157561389 AAGAGGAAACTGAGGGCCAGTGG - Intronic
1035358204 7:158292177-158292199 AGGAGGAAATTGAGACCTATCGG - Intronic
1035498634 8:73880-73902 AAGAGGAAATTGTGTCCATGTGG - Intronic
1036440410 8:8776963-8776985 AAGAGGAAACTGAGTGATAGTGG + Intergenic
1036640301 8:10579455-10579477 AAGAGAGAACTGAGAGCAGGAGG + Intergenic
1037103195 8:15073348-15073370 AAGAGGAAAGAGAGAGGATGGGG + Intronic
1037424531 8:18741127-18741149 AAGAGGGAGATGAGAGTAAGTGG + Intronic
1037634909 8:20692877-20692899 AAGAGAGAATAGAGAGTAAGTGG - Intergenic
1037723060 8:21460853-21460875 ATGAGGAAATTGAGTCCTAGAGG - Intergenic
1037945954 8:22989649-22989671 AAGAGGAAACTGAAGGCCAGAGG + Intronic
1038244566 8:25843329-25843351 AAGGGGAAATTGACAGGGAGAGG + Exonic
1039895007 8:41710814-41710836 AAGAGGAAAGGGAAAGAAAGGGG + Intronic
1040081323 8:43289124-43289146 AAGAGGAAAGTCAGGGCCAGAGG + Intergenic
1040631757 8:49221926-49221948 AAGAAGAAACTGAGAGACAGAGG + Intergenic
1041563572 8:59248776-59248798 GAGAGGAGATTGAGATAAAGGGG - Intergenic
1041720091 8:60967763-60967785 AAGAGGAAAAAGAAAGCAAAAGG - Intergenic
1042043261 8:64618615-64618637 AGGAGGAAATAGAGAGACAGAGG - Intronic
1042595350 8:70441237-70441259 AAGAGGAAAGAGAAAGAAAGGGG + Intergenic
1043560947 8:81492374-81492396 AAGAGGAATGAGAGAGGAAGGGG + Intergenic
1043856327 8:85269501-85269523 AAGAGGAAAGAGAGAGAAAGGGG + Intronic
1044091363 8:88006410-88006432 CAGAGGAAATTAAGAACAAAGGG + Intergenic
1044146823 8:88726055-88726077 AAGATGAAATTGAGAGCTATTGG + Intergenic
1044388958 8:91626105-91626127 AGGAGGAAATTGAGGCCTAGAGG + Intergenic
1044466601 8:92513890-92513912 CAGAGGAAAATAAGTGCAAGTGG - Intergenic
1044828508 8:96221893-96221915 AAGAGGACAGTGAGTGCAAAGGG - Intergenic
1045009595 8:97946111-97946133 AAGAGAAAATTGATAGGAATGGG - Intronic
1045235008 8:100343985-100344007 CAGAGAAAATGGAGACCAAGAGG + Intronic
1045743445 8:105388304-105388326 AAGAAGAAATGGAGAGAAAAGGG + Intronic
1046092976 8:109524907-109524929 AAGAGGAGAGAGAGAGGAAGAGG - Intronic
1046578509 8:116062847-116062869 AAGAAGACATTGAAATCAAGAGG - Intergenic
1047148474 8:122232742-122232764 AAGAGAAATTTGAGAGGAAAGGG - Intergenic
1047213765 8:122860622-122860644 AAGGGGAACTTGAAGGCAAGTGG + Intronic
1047561066 8:125988588-125988610 AACAGGAAGATGAGAGGAAGAGG + Intergenic
1047806047 8:128361014-128361036 TTGAGAAAATTGAGACCAAGAGG + Intergenic
1048217404 8:132509048-132509070 AAGAGGAAAGAGAGAGGATGAGG + Intergenic
1048699839 8:137076431-137076453 AAAGGGAAAGAGAGAGCAAGAGG - Intergenic
1049275227 8:141716994-141717016 CAGAGGGAAGTGACAGCAAGGGG - Intergenic
1049416460 8:142497732-142497754 AAGAGGACATTCAGAGAAAGGGG - Intronic
1049520464 8:143086107-143086129 AAGTGGAAATTGAATTCAAGTGG + Intergenic
1050949967 9:11576583-11576605 AAGGAGATAGTGAGAGCAAGAGG - Intergenic
1050977202 9:11954706-11954728 AAGAGAAAACTGAGAGCTAGTGG + Intergenic
1051147497 9:14043055-14043077 AAAAGAAAATTGATAACAAGAGG + Intergenic
1051364977 9:16315470-16315492 GAGAGGAAAAGGAGAGGAAGGGG + Intergenic
1051456783 9:17267969-17267991 AAGAGGAAATTCAAACCAATGGG - Intronic
1051494957 9:17710203-17710225 AAGAAGAAATGCAGAGCAAAAGG - Intronic
1051554612 9:18368514-18368536 AAGAGGAAATTGACTCAAAGAGG + Intergenic
1051751007 9:20340917-20340939 AAGGGGAAATTAAGACCAAGAGG + Intergenic
1052720701 9:32168458-32168480 AAGAGGAAATTGCAGGCAGGTGG + Intergenic
1053728865 9:41031985-41032007 AAGAGGAAGTCTAGAGGAAGTGG + Intergenic
1054699647 9:68400098-68400120 AAGAGGAAGTCTAGAGGAAGTGG - Intronic
1055360393 9:75483553-75483575 AAGGGGGCATTGATAGCAAGGGG - Intergenic
1056447733 9:86682479-86682501 AAGAGCAACATGAGAGTAAGGGG - Intergenic
1056578825 9:87875735-87875757 AAGAGGAAAGGGAGAGAAATTGG + Intergenic
1057167938 9:92942839-92942861 AAGAGGAAACTGAGACTCAGAGG - Intergenic
1057461150 9:95263275-95263297 AAGAGGAAATGGAGAGCTTAGGG - Intronic
1057629554 9:96708237-96708259 AAGAGGAAAGTGAGACAAAAGGG + Intergenic
1057742974 9:97728323-97728345 ATGAGGAAACTGAGACCAATGGG + Intergenic
1058188592 9:101886007-101886029 ATGAGAAAATTGAGAGAATGAGG + Intergenic
1058310716 9:103498447-103498469 AAGAGAAAATTCAGAACTAGAGG - Intergenic
1058471733 9:105286352-105286374 ATGAGGAAACTGAGACAAAGGGG - Intronic
1058698715 9:107583270-107583292 ATGAGGAAACTGAGGCCAAGAGG + Intergenic
1058783155 9:108359731-108359753 AAGAGGAAAATGAGAGCTCATGG - Intergenic
1059465815 9:114468210-114468232 AAGAGACAAGTGAGAGCATGTGG + Intronic
1059473715 9:114526855-114526877 AAAAAGAAAATGAGAGAAAGGGG + Intergenic
1059586309 9:115611058-115611080 AAGAGGAAACTGAGACTCAGAGG + Intergenic
1059744095 9:117183531-117183553 ACGAGGACAGTGAGAGGAAGGGG + Intronic
1059754760 9:117282160-117282182 AAGAAGAAACTGAGAGAATGGGG - Intronic
1060447815 9:123707771-123707793 AAGAGGAAATAGAGACCTAATGG + Intronic
1060822004 9:126666518-126666540 GAAAGGAAATTGAGGGCAAAAGG + Intronic
1061314798 9:129788275-129788297 ACGAGGAAACTGAGACCTAGAGG + Intergenic
1061414902 9:130442337-130442359 AAGTGGAAGTGGAGAGAAAGGGG + Intergenic
1062467194 9:136686641-136686663 AAGAGGAAAGGGAGAGAAAGGGG + Intronic
1203610361 Un_KI270748v1:90708-90730 AAGAGGAAATTGTGTCCATGTGG + Intergenic
1185622089 X:1456239-1456261 AAGGGCACATTGAGAGCAGGAGG - Intergenic
1186446214 X:9631370-9631392 AAGAGAAAACAAAGAGCAAGTGG - Intronic
1186460767 X:9746832-9746854 AAGAGGAAACTGAAGGCAAAGGG + Intronic
1187150736 X:16679429-16679451 CAGAGGAAAAAGAGAGAAAGTGG + Intronic
1187569416 X:20486008-20486030 AAGAAGAAAATGTGTGCAAGAGG - Intergenic
1187972365 X:24671726-24671748 AAGAAGAGATTGAGGGCCAGAGG - Intronic
1188867414 X:35330269-35330291 AAGGGTGAATGGAGAGCAAGGGG - Intergenic
1189246292 X:39566074-39566096 AAGAGGAAAATGGGAGCTAGAGG - Intergenic
1189327594 X:40122287-40122309 ATGAGGAAACTGAGGGCTAGAGG + Intronic
1189488990 X:41455061-41455083 ATGAGGAAACTGAGAGACAGAGG + Intronic
1189634149 X:42987226-42987248 AAGAGGAGAGAGACAGCAAGAGG + Intergenic
1190369121 X:49724761-49724783 AAGAGGAAAGAGCAAGCAAGAGG - Intergenic
1190524801 X:51317922-51317944 ACAAGGAAATTGAGAGGAGGTGG + Intergenic
1190545470 X:51522112-51522134 ACCAGGAAATTGAGAGGAGGTGG - Intergenic
1191024138 X:55895171-55895193 AAGATGAAGGAGAGAGCAAGGGG + Intergenic
1192085928 X:68097340-68097362 AAGAGGACATTCAAAGCAAGAGG + Intronic
1192537018 X:71936773-71936795 AAGAGGAAAATGAAAACAAGAGG + Intergenic
1193491143 X:82149423-82149445 AAGAGGAAATGGAGAGATATTGG + Intergenic
1193764010 X:85503505-85503527 AATGGGAAATTGAGAGGGAGTGG - Intergenic
1193968186 X:88016103-88016125 AGGAGGATATTGACAGTAAGGGG + Intergenic
1194739097 X:97550866-97550888 AAGAAGACATGCAGAGCAAGAGG + Intronic
1194831440 X:98627265-98627287 AAGAGGAAATGGAATGCAAGAGG + Intergenic
1195674033 X:107493322-107493344 ATGAGTTAATTGGGAGCAAGAGG - Intergenic
1195873734 X:109515579-109515601 AACTGGAAATTGATAACAAGAGG + Intergenic
1196087127 X:111695644-111695666 GAGAAGAAAATGAAAGCAAGTGG + Intronic
1196089896 X:111728855-111728877 ATGAGGAAATTGAGATTCAGAGG + Intronic
1196356533 X:114801018-114801040 AATAGGAAATGGAGAGCATTTGG + Intronic
1198035500 X:132797613-132797635 AGGAGGAGATGGAGAACAAGAGG + Intronic
1198743699 X:139867810-139867832 ATGAGGAAAAAGATAGCAAGAGG + Intronic
1199698550 X:150360883-150360905 CTGAGGAAGATGAGAGCAAGTGG + Intergenic
1199733387 X:150660140-150660162 AAGAGGAAAATGAGATAAACAGG - Intronic
1199751144 X:150819316-150819338 TATAGGATATTGAGAGCAAATGG - Intronic
1199976725 X:152898629-152898651 ATGAGGAAACTGAGACCCAGAGG + Intergenic
1200813514 Y:7508276-7508298 ACGAGGAAATTGAGACCAAGAGG + Intergenic
1201220933 Y:11769677-11769699 AAATGGAAATTGAAAGCAAGAGG - Intergenic