ID: 989410484

View in Genome Browser
Species Human (GRCh38)
Location 5:41114153-41114175
Sequence CAGAGAAAACAGAAGTATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989410484_989410488 26 Left 989410484 5:41114153-41114175 CCTGTATACTTCTGTTTTCTCTG No data
Right 989410488 5:41114202-41114224 TTGTACCTCTCATTTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989410484 Original CRISPR CAGAGAAAACAGAAGTATAC AGG (reversed) Intergenic
No off target data available for this crispr