ID: 989412775

View in Genome Browser
Species Human (GRCh38)
Location 5:41139793-41139815
Sequence CACTGGCACTGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989412775_989412782 8 Left 989412775 5:41139793-41139815 CCTTCTTCCCTCCAGTGCCAGTG No data
Right 989412782 5:41139824-41139846 TCCTCTTCTCTGTGCTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989412775 Original CRISPR CACTGGCACTGGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr