ID: 989412795

View in Genome Browser
Species Human (GRCh38)
Location 5:41139908-41139930
Sequence CAGTCTGACTAGGGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989412795_989412799 -7 Left 989412795 5:41139908-41139930 CCATCTTCTCCCTAGTCAGACTG No data
Right 989412799 5:41139924-41139946 CAGACTGCAACTATGAGAGAGGG No data
989412795_989412798 -8 Left 989412795 5:41139908-41139930 CCATCTTCTCCCTAGTCAGACTG No data
Right 989412798 5:41139923-41139945 TCAGACTGCAACTATGAGAGAGG No data
989412795_989412800 -6 Left 989412795 5:41139908-41139930 CCATCTTCTCCCTAGTCAGACTG No data
Right 989412800 5:41139925-41139947 AGACTGCAACTATGAGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989412795 Original CRISPR CAGTCTGACTAGGGAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr