ID: 989416748

View in Genome Browser
Species Human (GRCh38)
Location 5:41186931-41186953
Sequence TTGGAAAAGCATTAGCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989416748 Original CRISPR TTGGAAAAGCATTAGCATCT TGG (reversed) Intronic
900674879 1:3879130-3879152 TTGGAAAATGATAAGTATCTAGG + Intronic
903500785 1:23799194-23799216 TTGGAAATTAATTAGCCTCTTGG + Intronic
907971043 1:59382048-59382070 TTGAAAAAGATTTAGAATCTGGG + Intronic
908027381 1:59967342-59967364 TTGGCAAAGCATGAGCCTGTCGG + Intergenic
910334201 1:86109701-86109723 TTAGATAAGGATTAGGATCTTGG - Intronic
910526669 1:88186614-88186636 TTGAAAAAGAAATAGCATCTGGG - Intergenic
913711639 1:121490091-121490113 TTTGAAAAACATTTGCATATTGG + Intergenic
916793736 1:168146587-168146609 ATGGAAAAGCATTACCATCTGGG - Intergenic
917357010 1:174136668-174136690 TTGAAACAGAATTAGCCTCTTGG - Intergenic
919920439 1:202163815-202163837 CTGGAGAAGCACTAGGATCTCGG + Intergenic
1063437190 10:6043918-6043940 TTGGTAAAGAATTAACATTTGGG - Intronic
1068877883 10:62016671-62016693 TTAGAAAAGCACTGGCTTCTTGG + Intronic
1069294469 10:66826973-66826995 TTGGAAAATCATAAGTAACTTGG - Intronic
1073577007 10:104634848-104634870 TTGTTAAAGCTGTAGCATCTAGG + Intergenic
1075910136 10:126117444-126117466 TAGGACAAGCATTTGCAGCTTGG + Intronic
1076260513 10:129061218-129061240 TAGGAAAATCACTAGAATCTGGG - Intergenic
1084900468 11:72306378-72306400 TTAGAAAGGCAAGAGCATCTGGG + Intronic
1085420338 11:76353016-76353038 TTGTAACAGCATTTACATCTAGG - Intronic
1087133103 11:94686020-94686042 TTGGAAAAGCTTCAAAATCTTGG + Intergenic
1087395448 11:97590733-97590755 TTGCAAAAAGATTATCATCTGGG + Intergenic
1087835298 11:102868097-102868119 TGTGAAATGCATTATCATCTTGG + Intronic
1088179620 11:107093912-107093934 TTGCAAAAACATCATCATCTTGG + Intergenic
1088917941 11:114241269-114241291 TTGGGAAAGCATTAAAATCTAGG + Intronic
1090437308 11:126697416-126697438 TGGGAAAAGCTTTGGCAACTGGG - Intronic
1090983820 11:131748399-131748421 TTGGAAAGACATTAGGAGCTTGG + Intronic
1094383643 12:29870195-29870217 ATGGAAAAGAATTAGCTTCGTGG - Intergenic
1095993261 12:48053864-48053886 TTGGAAAAGCATTGGACTGTTGG - Intronic
1097347996 12:58516492-58516514 TTTGAAAAGAATCAGCATCTTGG + Intergenic
1097681054 12:62649398-62649420 ATGGGAAAGTATTAACATCTAGG + Intronic
1097974373 12:65668652-65668674 TTGGAAAATCCTCAGCATTTTGG - Intergenic
1105254061 13:18728472-18728494 TTGGTCAAACATTAGCATTTGGG + Intergenic
1106902895 13:34373091-34373113 TTGGAATAGTATTAGCAAATAGG - Intergenic
1108642118 13:52392817-52392839 TAGGAAGAGCAGTAGCACCTGGG + Intronic
1109134936 13:58635929-58635951 TTGGAAAAGTATATGCATATAGG - Intergenic
1110452493 13:75652335-75652357 TTGGAAAATTCTCAGCATCTAGG - Intronic
1112568847 13:100575125-100575147 TTGGAAGAACGTTAGCATATAGG - Intronic
1113355457 13:109575932-109575954 TAGGAAAAGCACTACCTTCTGGG - Intergenic
1114624696 14:24121257-24121279 TTGGAAAGGCATTTGTCTCTGGG + Intronic
1114842359 14:26280186-26280208 TTGGCAAGTCATTAACATCTGGG + Intergenic
1115667989 14:35575215-35575237 TCAGAAATGAATTAGCATCTGGG - Intronic
1120296658 14:82649940-82649962 TTGCAAAAGGATTAACATCAAGG - Intergenic
1122222017 14:100245563-100245585 ATGTAACAGCATTAGTATCTAGG - Intronic
1122286876 14:100657624-100657646 TTGGAGAGACATTAGCATCCAGG - Intergenic
1123815791 15:23977470-23977492 TTTGGAAAGTATAAGCATCTTGG + Intergenic
1123872108 15:24586391-24586413 TTTGGAAAGTATTAGCATCTTGG + Intergenic
1123996568 15:25722067-25722089 TTGGAAAAGTATTAGAGTATTGG + Intronic
1126202561 15:46003754-46003776 TTGAAAAAGTATTTTCATCTTGG + Intergenic
1126700742 15:51365097-51365119 TGGGAAAAGTATTAGAGTCTTGG + Intronic
1131067079 15:89441478-89441500 TGGGAAGAGCATGGGCATCTGGG - Intergenic
1133443078 16:5836823-5836845 GTGGACAAGCATTCTCATCTGGG - Intergenic
1135560195 16:23470250-23470272 ATGGAGAAGCAACAGCATCTGGG - Intronic
1138018589 16:53455799-53455821 TTGGAACAGGATTAGCTTTTTGG + Intronic
1139455324 16:67070417-67070439 TTGGAAATTCATTAGCATTGTGG - Intronic
1141340228 16:83196537-83196559 CTGAAAAAGGATTAGTATCTAGG + Intronic
1142530377 17:575716-575738 CTGGGAAAGCATTAGATTCTGGG - Intronic
1143438621 17:6950329-6950351 TTTGAAAAGCCTTAGGGTCTGGG - Intronic
1143680364 17:8471686-8471708 TTTGAAAAGCAGTAGCATGATGG + Intronic
1146655507 17:34632441-34632463 CTGTAAAAGCATTTGCATGTTGG + Intronic
1146661279 17:34666579-34666601 ATGGAAAAGCATGAGGAACTCGG - Intergenic
1149108276 17:52995443-52995465 TTGGAACATCATTAGCAACAGGG + Intergenic
1149434243 17:56619761-56619783 TCGGAAAAGCATTTGCAGCAAGG - Intergenic
1149652707 17:58286394-58286416 TGGGAAAATCATTTGAATCTGGG + Intergenic
1150835036 17:68556462-68556484 ATGGAAAAGCCTTAACATTTTGG + Intronic
1153447904 18:5195099-5195121 TTGAAAAATCATAAGCATTTGGG - Intronic
1153688845 18:7570866-7570888 CTGGAAAAGTATTAGGATTTGGG + Intronic
1154436977 18:14352373-14352395 TTGGTCAAACATTAGCATTTGGG - Intergenic
1158944986 18:62440533-62440555 ATAGAAAAGCATTAGCAACCTGG + Intergenic
1164401824 19:27907579-27907601 CTGGTAAACCATTATCATCTTGG - Intergenic
1168561382 19:57386617-57386639 TTGGAAAAATTTTAGAATCTTGG + Intronic
926929790 2:18025122-18025144 TTGGTTAAGCCCTAGCATCTGGG + Intronic
928806973 2:35170592-35170614 TTGAAAAAGCAATAATATCTTGG - Intergenic
931064743 2:58572826-58572848 ATGGCAAAGCACTAGCAGCTGGG + Intergenic
931455632 2:62407838-62407860 TGGGAGAAGCATTGGCCTCTTGG - Intergenic
931985557 2:67738485-67738507 TTGGAAGAGAAGTAGCATTTGGG - Intergenic
934488890 2:94744177-94744199 TTGGTCAAACATTAGCATTTGGG + Intergenic
935917784 2:107975294-107975316 TTGGAAAAGCCTTAGAAATTTGG + Intergenic
938744418 2:134263392-134263414 TAGGAAAAACATTCGCTTCTGGG + Intronic
939310089 2:140464819-140464841 TTTGAAAAGCATTTGCCTCTGGG + Intronic
940326096 2:152426620-152426642 TTGAAAAAACATCAGTATCTGGG - Intronic
941566851 2:167119248-167119270 TTAGATAAACATTGGCATCTTGG + Intronic
941810679 2:169753394-169753416 CTGAAAGAGGATTAGCATCTAGG + Intronic
941860675 2:170276391-170276413 TTGGATAACCATAAGCATATGGG - Intronic
942372064 2:175295711-175295733 TTGGGCAAGTATCAGCATCTGGG + Intergenic
943434438 2:187847115-187847137 ATGTAGAAGCATTTGCATCTAGG - Intergenic
944022058 2:195116542-195116564 CTGGAAAAGCATTTGCGTTTGGG - Intergenic
944567622 2:201006473-201006495 TGGGAAATACATTAGCACCTTGG + Intronic
1169574106 20:6939367-6939389 TTAGAAAAGCATTAGCCTCTAGG - Intergenic
1170324889 20:15146722-15146744 TTAGAAAAGTAATAGCTTCTGGG + Intronic
1171252791 20:23662326-23662348 TAGGAAAAACCTTAGCATCTCGG + Intergenic
1171336659 20:24391582-24391604 TTGGAAAAGAGTTAAAATCTTGG + Intergenic
1173695276 20:45005348-45005370 TTTAAAAAACATTAGCAGCTGGG + Intronic
1176840060 21:13833270-13833292 TTGGTCAAACATTAGCATTTGGG + Intergenic
1177389821 21:20453600-20453622 TTTGCAATGCATTAGAATCTGGG + Intergenic
1178026839 21:28477992-28478014 AGGGAAACCCATTAGCATCTTGG - Intergenic
1178378495 21:32088947-32088969 TTAGCAAAGCATTAGTATCTTGG - Intergenic
1178535408 21:33406075-33406097 TTTGAAAAGTAGTAGCAGCTGGG + Intronic
1183608678 22:38882777-38882799 TTGGAAATGCATCTGCCTCTTGG - Intergenic
1183870742 22:40740114-40740136 TTGGAAAAGAAATCGCATCAGGG - Intergenic
950693088 3:14676315-14676337 TTGGAAAAGCAATAAAACCTGGG - Intronic
951414162 3:22402701-22402723 TTGTAAAGGCATTAGGATGTTGG - Intergenic
951675233 3:25232398-25232420 TTTAAAAAGAATTGGCATCTTGG + Intronic
951804662 3:26631170-26631192 TTGGAGAAGCAATAGCCTCCTGG + Intronic
953591723 3:44263022-44263044 TTGGAGAAGCATCATCATGTAGG + Intronic
953619197 3:44518225-44518247 TTTAAAAAGCATTTGCAGCTGGG - Intergenic
953742494 3:45549599-45549621 TTGCAAAAGCTTTATCCTCTTGG - Intergenic
954570893 3:51639930-51639952 GTGGAAAAGCAGTACCATCTTGG - Exonic
956659968 3:71587724-71587746 TTGGACAAGGATTAGAATCCAGG + Intergenic
957651442 3:83011023-83011045 GTGAAAAATCATTAGCATCAAGG - Intergenic
958137117 3:89508365-89508387 TTGCAAGAGCATTAGAAACTTGG - Intergenic
959593739 3:108106236-108106258 TAGGAAAGGCATTGGCCTCTCGG + Intergenic
962621674 3:137186466-137186488 TAAGGAAAGTATTAGCATCTTGG - Intergenic
964710744 3:159668884-159668906 TTAGATAAGCATTAGCATTCTGG - Intronic
964723935 3:159794921-159794943 CTTAAAAAGCATGAGCATCTGGG + Intronic
965432086 3:168601518-168601540 ATGGAAATGCATCAACATCTGGG - Intergenic
965762859 3:172098579-172098601 TTGAAAAAGCAGTAGATTCTTGG + Intronic
966239488 3:177740536-177740558 TTGGGAAAGCATCAACATTTAGG + Intergenic
966290695 3:178354352-178354374 TTGGCAAAGGATTAGGATTTGGG + Intergenic
966655438 3:182352301-182352323 TTGGAAGAACAATAGCCTCTAGG + Intergenic
970707989 4:18828693-18828715 ATGGAAAAGAATGACCATCTTGG - Intergenic
971199285 4:24497367-24497389 ATGGAATTGCATTAGCATTTTGG - Intergenic
977144120 4:93414012-93414034 TTGGAAGAGTATTAACTTCTGGG - Intronic
978648617 4:110972663-110972685 TTAGAAAAGCATGAGGATCAAGG - Intergenic
979337148 4:119476355-119476377 CTGGCAAAGCCTCAGCATCTGGG - Intergenic
979956319 4:126957082-126957104 TTTGAAAATTATTGGCATCTTGG - Intergenic
980223359 4:129948161-129948183 TTGGAAAAAGCATAGCATCTGGG + Intergenic
982108023 4:152028321-152028343 TTGTAAAAGCATTAGAGTCCAGG + Intergenic
982198875 4:152940207-152940229 TAGTAAAAGCATTAGCGTCTTGG + Intronic
983082493 4:163404045-163404067 ATGGAATAACATTAGCATCAGGG - Intergenic
984863416 4:184259610-184259632 TGGGAAAAGAATTAGCAGATTGG - Intergenic
986477394 5:8149418-8149440 TTCTAAAAAAATTAGCATCTGGG - Intergenic
987157461 5:15104442-15104464 TTGGGAATGCAACAGCATCTGGG + Intergenic
988876014 5:35446597-35446619 TTGCAAAAAGATTATCATCTAGG + Intergenic
989416748 5:41186931-41186953 TTGGAAAAGCATTAGCATCTTGG - Intronic
992011448 5:72531716-72531738 TTGGGAAAGCATTTTCTTCTTGG - Intergenic
992794759 5:80245402-80245424 TTGGAAAAGGAGTAGAAGCTGGG - Intronic
994144571 5:96379840-96379862 AAGGAAAAGCATTCGAATCTGGG + Intergenic
994735507 5:103549019-103549041 TTGGGAAAAAATCAGCATCTAGG - Exonic
996808720 5:127489041-127489063 GTGGGCAAGCATTACCATCTGGG - Intergenic
1004892436 6:20114434-20114456 TTTTAAAAGCATAAACATCTGGG + Intronic
1005407668 6:25507229-25507251 TTGGGAAAGCTTTAGCTTTTGGG + Intronic
1008090783 6:47291694-47291716 TTGGAAAGCCATTAGCAAATTGG - Intronic
1010222286 6:73458326-73458348 TTGCAAAAGGATCAGCTTCTGGG - Intergenic
1014171658 6:118285621-118285643 TTGGAAAAAGAGTAGCTTCTGGG - Intronic
1014882808 6:126744273-126744295 TTTGAAGAGCATTTGCATCATGG + Intergenic
1015337242 6:132053879-132053901 TTGGAAAATCAGTTGCTTCTTGG + Intergenic
1015414247 6:132930782-132930804 TTAGAAAAGCATTTTCTTCTGGG - Intergenic
1016924172 6:149325620-149325642 TAGGAAAAGCATTAGAAAATTGG + Intronic
1017333859 6:153231718-153231740 TTTGAAAGGCAATAGCATCAGGG - Intergenic
1021763575 7:23924975-23924997 TTGGAAATGCAGCAGCATCTAGG - Intergenic
1025030647 7:55554057-55554079 TTGGATAAGCTTTTGCATTTTGG - Intronic
1026980925 7:74526205-74526227 TTGGAAAAGGCTTGGCATTTTGG - Intronic
1028108719 7:86912699-86912721 TTGGAAAAGCATTCTTATTTGGG + Intronic
1028730284 7:94139658-94139680 TTGGAAAGTCATAAGCATATTGG + Intergenic
1029860451 7:103565750-103565772 TTTGAAAAGCATTACCACCTTGG + Intronic
1031520415 7:122757973-122757995 TAGGAAAAGCATCATTATCTTGG - Intronic
1031859988 7:126967643-126967665 TTGAAGAAGCATTTGCATTTGGG - Intronic
1032349023 7:131142996-131143018 TTTGAAAAGCATTACTATATAGG - Intronic
1034761156 7:153673082-153673104 CTTGAAAAGCATCAGCATGTAGG - Intergenic
1037466413 8:19165323-19165345 TTCTTAAAGCATTAGAATCTGGG + Intergenic
1038047341 8:23776764-23776786 TTGGAAATGCATTAGGTGCTGGG + Intergenic
1041563069 8:59242695-59242717 GAGGAAAAGCAGTAGAATCTGGG - Intergenic
1043613859 8:82101201-82101223 TTGGAAAAGCATCTTCATCTAGG + Intergenic
1044378098 8:91500002-91500024 TGGGAAAAGCATAATTATCTGGG + Intergenic
1044863621 8:96547657-96547679 ATGCAAAAGCATGAGCGTCTAGG + Intronic
1046030506 8:108777688-108777710 TAGGAAAAGAATTAAAATCTGGG - Intronic
1047502237 8:125451164-125451186 TGGAAAAAGAATTCGCATCTGGG - Intergenic
1048676371 8:136786997-136787019 TTGGAAAAGTATTAGGATCCAGG + Intergenic
1050171296 9:2820839-2820861 TTGGAACAGTATTAGCATCATGG - Intronic
1052254820 9:26443905-26443927 GTGTAAAAGCAGTAGCATCACGG - Intergenic
1053918695 9:42966445-42966467 TTGGTCAAACATTAGCATTTGGG - Intergenic
1058637658 9:107051989-107052011 TTAGATAAGCATTATCACCTTGG - Intergenic
1060478404 9:124001597-124001619 TTTTAAAAGCAGCAGCATCTGGG - Intergenic
1060999517 9:127895247-127895269 GAGGAAAAGCATTTGCTTCTTGG + Intronic
1061524647 9:131149376-131149398 TTGGAAAAGGACTAGCCTCTAGG - Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1189474970 X:41344893-41344915 TTGAAAAATCAGTAACATCTTGG + Intronic
1189778015 X:44487572-44487594 TTGAAAAAGTATTAGTACCTGGG - Intergenic
1190452990 X:50599201-50599223 TTGGAAAAGCATTTGCACTAAGG + Intronic
1191021233 X:55862574-55862596 TTGGCAACGCATTAGGCTCTGGG - Intergenic
1191862032 X:65673641-65673663 TTTTAAAGGCATTTGCATCTAGG + Intronic
1196399136 X:115295557-115295579 TTAGAAAAGCAGTAGTATGTTGG + Intronic
1196702493 X:118686810-118686832 TTGCCAAAGCTTTATCATCTGGG + Intergenic
1197780246 X:130152064-130152086 TTGGAAAAGCTTTCCCCTCTAGG - Intronic
1199818449 X:151421078-151421100 ATGGAAAAGCATTAACATTAGGG + Intergenic
1199827465 X:151514951-151514973 TTTGAAAACCATTAACTTCTTGG - Intergenic