ID: 989425508

View in Genome Browser
Species Human (GRCh38)
Location 5:41291141-41291163
Sequence TCTTGCCTTCTTGGGGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989425508_989425520 23 Left 989425508 5:41291141-41291163 CCTGAGCCCCCAAGAAGGCAAGA No data
Right 989425520 5:41291187-41291209 TGGGTGCTGCAGTTGCTCCCAGG No data
989425508_989425514 3 Left 989425508 5:41291141-41291163 CCTGAGCCCCCAAGAAGGCAAGA No data
Right 989425514 5:41291167-41291189 CCCCCATACAGAGCCTCAGCTGG No data
989425508_989425521 30 Left 989425508 5:41291141-41291163 CCTGAGCCCCCAAGAAGGCAAGA No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data
989425508_989425516 4 Left 989425508 5:41291141-41291163 CCTGAGCCCCCAAGAAGGCAAGA No data
Right 989425516 5:41291168-41291190 CCCCATACAGAGCCTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989425508 Original CRISPR TCTTGCCTTCTTGGGGGCTC AGG (reversed) Intergenic
No off target data available for this crispr