ID: 989425511

View in Genome Browser
Species Human (GRCh38)
Location 5:41291149-41291171
Sequence GGGGGCATTCTTGCCTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989425511_989425521 22 Left 989425511 5:41291149-41291171 CCCAAGAAGGCAAGAATGCCCCC No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data
989425511_989425514 -5 Left 989425511 5:41291149-41291171 CCCAAGAAGGCAAGAATGCCCCC No data
Right 989425514 5:41291167-41291189 CCCCCATACAGAGCCTCAGCTGG No data
989425511_989425523 24 Left 989425511 5:41291149-41291171 CCCAAGAAGGCAAGAATGCCCCC No data
Right 989425523 5:41291196-41291218 CAGTTGCTCCCAGGAGTATGGGG No data
989425511_989425522 23 Left 989425511 5:41291149-41291171 CCCAAGAAGGCAAGAATGCCCCC No data
Right 989425522 5:41291195-41291217 GCAGTTGCTCCCAGGAGTATGGG No data
989425511_989425516 -4 Left 989425511 5:41291149-41291171 CCCAAGAAGGCAAGAATGCCCCC No data
Right 989425516 5:41291168-41291190 CCCCATACAGAGCCTCAGCTGGG No data
989425511_989425520 15 Left 989425511 5:41291149-41291171 CCCAAGAAGGCAAGAATGCCCCC No data
Right 989425520 5:41291187-41291209 TGGGTGCTGCAGTTGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989425511 Original CRISPR GGGGGCATTCTTGCCTTCTT GGG (reversed) Intergenic
No off target data available for this crispr