ID: 989425512

View in Genome Browser
Species Human (GRCh38)
Location 5:41291150-41291172
Sequence TGGGGGCATTCTTGCCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989425512_989425514 -6 Left 989425512 5:41291150-41291172 CCAAGAAGGCAAGAATGCCCCCA No data
Right 989425514 5:41291167-41291189 CCCCCATACAGAGCCTCAGCTGG No data
989425512_989425516 -5 Left 989425512 5:41291150-41291172 CCAAGAAGGCAAGAATGCCCCCA No data
Right 989425516 5:41291168-41291190 CCCCATACAGAGCCTCAGCTGGG No data
989425512_989425522 22 Left 989425512 5:41291150-41291172 CCAAGAAGGCAAGAATGCCCCCA No data
Right 989425522 5:41291195-41291217 GCAGTTGCTCCCAGGAGTATGGG No data
989425512_989425520 14 Left 989425512 5:41291150-41291172 CCAAGAAGGCAAGAATGCCCCCA No data
Right 989425520 5:41291187-41291209 TGGGTGCTGCAGTTGCTCCCAGG No data
989425512_989425523 23 Left 989425512 5:41291150-41291172 CCAAGAAGGCAAGAATGCCCCCA No data
Right 989425523 5:41291196-41291218 CAGTTGCTCCCAGGAGTATGGGG No data
989425512_989425521 21 Left 989425512 5:41291150-41291172 CCAAGAAGGCAAGAATGCCCCCA No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989425512 Original CRISPR TGGGGGCATTCTTGCCTTCT TGG (reversed) Intergenic
No off target data available for this crispr