ID: 989425514

View in Genome Browser
Species Human (GRCh38)
Location 5:41291167-41291189
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989425511_989425514 -5 Left 989425511 5:41291149-41291171 CCCAAGAAGGCAAGAATGCCCCC No data
Right 989425514 5:41291167-41291189 CCCCCATACAGAGCCTCAGCTGG No data
989425512_989425514 -6 Left 989425512 5:41291150-41291172 CCAAGAAGGCAAGAATGCCCCCA No data
Right 989425514 5:41291167-41291189 CCCCCATACAGAGCCTCAGCTGG No data
989425509_989425514 -3 Left 989425509 5:41291147-41291169 CCCCCAAGAAGGCAAGAATGCCC No data
Right 989425514 5:41291167-41291189 CCCCCATACAGAGCCTCAGCTGG No data
989425508_989425514 3 Left 989425508 5:41291141-41291163 CCTGAGCCCCCAAGAAGGCAAGA No data
Right 989425514 5:41291167-41291189 CCCCCATACAGAGCCTCAGCTGG No data
989425510_989425514 -4 Left 989425510 5:41291148-41291170 CCCCAAGAAGGCAAGAATGCCCC No data
Right 989425514 5:41291167-41291189 CCCCCATACAGAGCCTCAGCTGG No data
989425506_989425514 25 Left 989425506 5:41291119-41291141 CCTGTGGGGGACAGGGGCATTTC No data
Right 989425514 5:41291167-41291189 CCCCCATACAGAGCCTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr