ID: 989425517

View in Genome Browser
Species Human (GRCh38)
Location 5:41291169-41291191
Sequence ACCCAGCTGAGGCTCTGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989425517_989425522 3 Left 989425517 5:41291169-41291191 CCCATACAGAGCCTCAGCTGGGT No data
Right 989425522 5:41291195-41291217 GCAGTTGCTCCCAGGAGTATGGG No data
989425517_989425521 2 Left 989425517 5:41291169-41291191 CCCATACAGAGCCTCAGCTGGGT No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data
989425517_989425528 29 Left 989425517 5:41291169-41291191 CCCATACAGAGCCTCAGCTGGGT No data
Right 989425528 5:41291221-41291243 CCCACCCCCCAACTCAGTAAGGG No data
989425517_989425523 4 Left 989425517 5:41291169-41291191 CCCATACAGAGCCTCAGCTGGGT No data
Right 989425523 5:41291196-41291218 CAGTTGCTCCCAGGAGTATGGGG No data
989425517_989425526 28 Left 989425517 5:41291169-41291191 CCCATACAGAGCCTCAGCTGGGT No data
Right 989425526 5:41291220-41291242 TCCCACCCCCCAACTCAGTAAGG No data
989425517_989425520 -5 Left 989425517 5:41291169-41291191 CCCATACAGAGCCTCAGCTGGGT No data
Right 989425520 5:41291187-41291209 TGGGTGCTGCAGTTGCTCCCAGG No data
989425517_989425530 30 Left 989425517 5:41291169-41291191 CCCATACAGAGCCTCAGCTGGGT No data
Right 989425530 5:41291222-41291244 CCACCCCCCAACTCAGTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989425517 Original CRISPR ACCCAGCTGAGGCTCTGTAT GGG (reversed) Intergenic
No off target data available for this crispr