ID: 989425518

View in Genome Browser
Species Human (GRCh38)
Location 5:41291170-41291192
Sequence CACCCAGCTGAGGCTCTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989425518_989425526 27 Left 989425518 5:41291170-41291192 CCATACAGAGCCTCAGCTGGGTG No data
Right 989425526 5:41291220-41291242 TCCCACCCCCCAACTCAGTAAGG No data
989425518_989425522 2 Left 989425518 5:41291170-41291192 CCATACAGAGCCTCAGCTGGGTG No data
Right 989425522 5:41291195-41291217 GCAGTTGCTCCCAGGAGTATGGG No data
989425518_989425530 29 Left 989425518 5:41291170-41291192 CCATACAGAGCCTCAGCTGGGTG No data
Right 989425530 5:41291222-41291244 CCACCCCCCAACTCAGTAAGGGG No data
989425518_989425528 28 Left 989425518 5:41291170-41291192 CCATACAGAGCCTCAGCTGGGTG No data
Right 989425528 5:41291221-41291243 CCCACCCCCCAACTCAGTAAGGG No data
989425518_989425523 3 Left 989425518 5:41291170-41291192 CCATACAGAGCCTCAGCTGGGTG No data
Right 989425523 5:41291196-41291218 CAGTTGCTCCCAGGAGTATGGGG No data
989425518_989425521 1 Left 989425518 5:41291170-41291192 CCATACAGAGCCTCAGCTGGGTG No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data
989425518_989425520 -6 Left 989425518 5:41291170-41291192 CCATACAGAGCCTCAGCTGGGTG No data
Right 989425520 5:41291187-41291209 TGGGTGCTGCAGTTGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989425518 Original CRISPR CACCCAGCTGAGGCTCTGTA TGG (reversed) Intergenic
No off target data available for this crispr