ID: 989425519

View in Genome Browser
Species Human (GRCh38)
Location 5:41291180-41291202
Sequence GCAACTGCAGCACCCAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989425519_989425522 -8 Left 989425519 5:41291180-41291202 CCTCAGCTGGGTGCTGCAGTTGC No data
Right 989425522 5:41291195-41291217 GCAGTTGCTCCCAGGAGTATGGG No data
989425519_989425530 19 Left 989425519 5:41291180-41291202 CCTCAGCTGGGTGCTGCAGTTGC No data
Right 989425530 5:41291222-41291244 CCACCCCCCAACTCAGTAAGGGG No data
989425519_989425526 17 Left 989425519 5:41291180-41291202 CCTCAGCTGGGTGCTGCAGTTGC No data
Right 989425526 5:41291220-41291242 TCCCACCCCCCAACTCAGTAAGG No data
989425519_989425534 24 Left 989425519 5:41291180-41291202 CCTCAGCTGGGTGCTGCAGTTGC No data
Right 989425534 5:41291227-41291249 CCCCAACTCAGTAAGGGGCAAGG No data
989425519_989425523 -7 Left 989425519 5:41291180-41291202 CCTCAGCTGGGTGCTGCAGTTGC No data
Right 989425523 5:41291196-41291218 CAGTTGCTCCCAGGAGTATGGGG No data
989425519_989425521 -9 Left 989425519 5:41291180-41291202 CCTCAGCTGGGTGCTGCAGTTGC No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data
989425519_989425528 18 Left 989425519 5:41291180-41291202 CCTCAGCTGGGTGCTGCAGTTGC No data
Right 989425528 5:41291221-41291243 CCCACCCCCCAACTCAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989425519 Original CRISPR GCAACTGCAGCACCCAGCTG AGG (reversed) Intergenic
No off target data available for this crispr