ID: 989425521

View in Genome Browser
Species Human (GRCh38)
Location 5:41291194-41291216
Sequence TGCAGTTGCTCCCAGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989425508_989425521 30 Left 989425508 5:41291141-41291163 CCTGAGCCCCCAAGAAGGCAAGA No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data
989425519_989425521 -9 Left 989425519 5:41291180-41291202 CCTCAGCTGGGTGCTGCAGTTGC No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data
989425510_989425521 23 Left 989425510 5:41291148-41291170 CCCCAAGAAGGCAAGAATGCCCC No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data
989425518_989425521 1 Left 989425518 5:41291170-41291192 CCATACAGAGCCTCAGCTGGGTG No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data
989425509_989425521 24 Left 989425509 5:41291147-41291169 CCCCCAAGAAGGCAAGAATGCCC No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data
989425513_989425521 4 Left 989425513 5:41291167-41291189 CCCCCATACAGAGCCTCAGCTGG No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data
989425511_989425521 22 Left 989425511 5:41291149-41291171 CCCAAGAAGGCAAGAATGCCCCC No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data
989425515_989425521 3 Left 989425515 5:41291168-41291190 CCCCATACAGAGCCTCAGCTGGG No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data
989425512_989425521 21 Left 989425512 5:41291150-41291172 CCAAGAAGGCAAGAATGCCCCCA No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data
989425517_989425521 2 Left 989425517 5:41291169-41291191 CCCATACAGAGCCTCAGCTGGGT No data
Right 989425521 5:41291194-41291216 TGCAGTTGCTCCCAGGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989425521 Original CRISPR TGCAGTTGCTCCCAGGAGTA TGG Intergenic
No off target data available for this crispr