ID: 989427143

View in Genome Browser
Species Human (GRCh38)
Location 5:41309061-41309083
Sequence ACAATGTGCCCTTTTTCTTT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 412}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989427140_989427143 24 Left 989427140 5:41309014-41309036 CCAAATTGCAAAAACAACAAAAA 0: 1
1: 1
2: 36
3: 407
4: 4411
Right 989427143 5:41309061-41309083 ACAATGTGCCCTTTTTCTTTAGG 0: 1
1: 0
2: 4
3: 35
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989427143 Original CRISPR ACAATGTGCCCTTTTTCTTT AGG Exonic
900812672 1:4819658-4819680 TCAAGGTGGCCTTTTTCTTATGG + Intergenic
900885253 1:5410543-5410565 ACCATGTGCCCTCTTGCCTTGGG + Intergenic
902082797 1:13832778-13832800 CCAACGTGCCCTTTGTCTTCTGG + Intergenic
902492992 1:16798965-16798987 ACAATTTCCCCTCTATCTTTGGG - Intronic
903792275 1:25902341-25902363 ACAATGAGCTAGTTTTCTTTGGG - Intronic
905480213 1:38256650-38256672 ACAAGGTTCCATTTTTTTTTTGG + Intergenic
907944406 1:59121740-59121762 ATAATGTGTCTTTTTTCCTTTGG + Intergenic
908347148 1:63245674-63245696 ACATTGTGAACTTTTTTTTTTGG - Intergenic
908360566 1:63365377-63365399 CCAATGTGCCTTTCTCCTTTTGG + Intergenic
908467485 1:64412096-64412118 AAATTGTTCCCTTTATCTTTAGG + Intergenic
908627573 1:66062311-66062333 ATAAAGTGCCATTTTTATTTAGG - Intronic
908895146 1:68889894-68889916 AGAATGTTCCCTGCTTCTTTTGG - Intergenic
909010114 1:70324937-70324959 AGAATGTGCCCATTTACTTTTGG - Exonic
909060453 1:70873236-70873258 GCTATGTGCCTTCTTTCTTTAGG + Intronic
909201082 1:72691145-72691167 ACAATGAGTCATTTTACTTTAGG + Intergenic
909283155 1:73783258-73783280 TCAATGTACTCTTCTTCTTTGGG - Intergenic
909551698 1:76905160-76905182 ACGATGTGCTCTCTATCTTTAGG - Intronic
910080151 1:83332013-83332035 TCCATCTGCCCCTTTTCTTTTGG + Intergenic
910276059 1:85450107-85450129 ACAAGTTGCGTTTTTTCTTTAGG + Intronic
911516548 1:98874785-98874807 ACAAATTTCCCTGTTTCTTTGGG + Intergenic
911623090 1:100089497-100089519 ATAAAGTGACCTTTTTCTCTGGG - Intronic
911771176 1:101744367-101744389 ACAATTTCCCCTGTATCTTTGGG + Intergenic
911773768 1:101781817-101781839 ACACTGTGGCCTTTTGGTTTTGG - Intergenic
912775690 1:112505078-112505100 ACAGTGGACCCTTCTTCTTTGGG + Intronic
914974467 1:152348157-152348179 ACAGTCTGCACATTTTCTTTGGG + Intergenic
915891738 1:159780129-159780151 ACAATGTTCCATTTAACTTTAGG + Intergenic
916247639 1:162704933-162704955 AAGATTTGCCCTTTTGCTTTTGG + Intronic
916316673 1:163456136-163456158 ACATTATATCCTTTTTCTTTAGG - Intergenic
917055292 1:170975155-170975177 ACAATCTGCCTTTTTACTTGGGG - Intronic
918240036 1:182612859-182612881 ACAATTTCCCCTGTGTCTTTGGG - Intergenic
918548973 1:185717957-185717979 ACAATGTGCCATTTTGGTGTTGG + Intergenic
918872769 1:189997764-189997786 ATAATGATTCCTTTTTCTTTGGG - Intergenic
919208725 1:194452644-194452666 CCTATGTGACCTTTTGCTTTGGG + Intergenic
921808615 1:219485547-219485569 ACAATGTGTCTTTTTTCCTCTGG + Intergenic
923219179 1:231877326-231877348 ACAACATGACCTTTTTCTCTTGG - Intronic
923260952 1:232267561-232267583 ACCATGAGCCATTTTTCTTATGG - Intergenic
923263922 1:232294326-232294348 AGAATGAGCTATTTTTCTTTGGG + Intergenic
923527453 1:234783563-234783585 ACAATTTCCCCTCTATCTTTGGG + Intergenic
924041799 1:239991162-239991184 ATAATGTGCCCTTTTCTTCTTGG + Intergenic
924557397 1:245129735-245129757 ACGATGTGCCCTTTCTGCTTTGG + Intergenic
924582299 1:245332942-245332964 ACATTTTGCCCTTTTTCTGCTGG - Intronic
924930983 1:248732256-248732278 ACTATTTGTCTTTTTTCTTTTGG - Intronic
1062966909 10:1614922-1614944 ATAAAATGCCCTTTTTGTTTTGG + Intronic
1063166671 10:3469741-3469763 TCAACTTGGCCTTTTTCTTTGGG - Intergenic
1064634042 10:17345693-17345715 ACAATGTGGCTTTCTTCTATGGG + Intronic
1065264371 10:23959625-23959647 ACAAGTTTCCCTGTTTCTTTGGG - Intronic
1066268582 10:33799827-33799849 AGAATGTGCCCTTTTTGCTCTGG - Intergenic
1067014692 10:42749077-42749099 ACATTGTGCCATTTTTCGTGTGG + Intergenic
1069253633 10:66304068-66304090 ACATTGATCCATTTTTCTTTGGG - Intronic
1070196762 10:74164545-74164567 AAAATTTGTCCTTTTTTTTTGGG + Intronic
1070542947 10:77430086-77430108 ACAAAGTTCACTCTTTCTTTTGG - Intronic
1073692121 10:105820695-105820717 ACAGAATGCCCTTTTTCTTTGGG - Intergenic
1074922539 10:118031296-118031318 TCAATAGGCTCTTTTTCTTTAGG + Intronic
1075535371 10:123267071-123267093 AGCATTTGTCCTTTTTCTTTTGG + Intergenic
1076253449 10:129000893-129000915 ACTGTGTGGCCTTTTGCTTTGGG - Intergenic
1076285317 10:129289984-129290006 ACAATGTCTCCTTGTTCTGTTGG - Intergenic
1076620273 10:131782778-131782800 ACCATGTGCACTGCTTCTTTGGG + Intergenic
1078810886 11:14761846-14761868 AAAATGTACCATTTTTATTTGGG - Intronic
1079382549 11:19950813-19950835 ACAATCTCCCCTATATCTTTGGG - Intronic
1079824971 11:25179440-25179462 ACATTGCTCTCTTTTTCTTTTGG + Intergenic
1081885842 11:46495498-46495520 ACAGTGTACGCTTTCTCTTTTGG - Intronic
1084212729 11:67631366-67631388 ATACTGTGCCCTCTTGCTTTGGG - Exonic
1084625868 11:70306114-70306136 GCAAAGTGACCTTTTTCTTTTGG + Intronic
1086279316 11:85167700-85167722 ACAGGTTTCCCTTTTTCTTTAGG + Intronic
1087020377 11:93596538-93596560 ACAATTTCCCCTGTATCTTTGGG + Intergenic
1087805476 11:102551064-102551086 GCAATTTGCCTTTTTACTTTTGG + Intergenic
1089114320 11:116081908-116081930 ACAATGTGCTTTTTTTTTCTTGG - Intergenic
1090206286 11:124886205-124886227 ACAATTTGTCCTTGTTCTGTGGG + Intronic
1090234576 11:125138154-125138176 TCAGTCTGCCCTTTTTCATTCGG + Intergenic
1090808034 11:130215093-130215115 CCAATGAGTCCTCTTTCTTTTGG + Intergenic
1091942329 12:4499095-4499117 ACAATATAGCATTTTTCTTTTGG + Intronic
1092080035 12:5708365-5708387 AGAATTTGACCTTTTTCTTAAGG - Intronic
1093799877 12:23360629-23360651 CCAATGTGGTATTTTTCTTTTGG - Intergenic
1093824324 12:23664614-23664636 ACAATGTGCAATTTATATTTGGG + Intronic
1094702598 12:32884472-32884494 ACAGTCTTCCCTGTTTCTTTGGG + Intronic
1095710588 12:45284072-45284094 ACAATTTCCCCTGTATCTTTGGG - Intronic
1095840356 12:46685415-46685437 ACAATGGGGCCATTTTCTGTAGG + Intergenic
1096193566 12:49634879-49634901 ATACTGGGCCCTTTTCCTTTGGG - Intronic
1096287138 12:50309981-50310003 ACAATTTTCCCTGTTTCTTTGGG - Intergenic
1097689808 12:62724177-62724199 ACAGTTTGCCCTGTTTCCTTGGG + Intronic
1098790387 12:74815506-74815528 AAGATGTGCCCTTTTCTTTTTGG + Intergenic
1099111624 12:78569100-78569122 ACAATTTGTCCTGTATCTTTAGG - Intergenic
1099456338 12:82867091-82867113 TCAGTGTGCCCTTGTTCTCTGGG + Intronic
1099701565 12:86089742-86089764 ACATTTTGCCATTTTGCTTTAGG + Intronic
1099937965 12:89150717-89150739 ACAATGAGTTATTTTTCTTTGGG - Intergenic
1100071019 12:90717881-90717903 ACAAGGTGTCTTTTTTCCTTTGG + Intergenic
1100373394 12:93990473-93990495 ACAATTTTCCTTGTTTCTTTGGG - Intergenic
1101010489 12:100444378-100444400 TCATTTTGCCCTTTTTCATTTGG + Intergenic
1101215154 12:102574128-102574150 ACAATGATCCATTTTTCTCTTGG + Intergenic
1101246656 12:102890271-102890293 ACAAAATGCCCTTTTTATTGTGG - Intronic
1102478170 12:113202225-113202247 ACAAGGTCCCCCTTTTCTTGTGG + Intronic
1102595048 12:113985931-113985953 AAAAAGTGCCATTTTTCTTTGGG + Intergenic
1103124105 12:118406705-118406727 AAAATGTGCGTTTTTTTTTTAGG - Intronic
1103678914 12:122677942-122677964 ACAATTTCCCCTGTGTCTTTTGG + Intergenic
1104374455 12:128251517-128251539 TCAATCACCCCTTTTTCTTTTGG - Intergenic
1105547194 13:21359497-21359519 GTTATGTGACCTTTTTCTTTTGG - Intergenic
1105592284 13:21803952-21803974 ATAATGACTCCTTTTTCTTTGGG + Intergenic
1105804218 13:23940694-23940716 ACAAGGTGCTCTTTAGCTTTGGG - Intergenic
1106828187 13:33547127-33547149 ACAGTGTTTTCTTTTTCTTTTGG + Intergenic
1106925117 13:34605699-34605721 ACAAGTTGACCTGTTTCTTTGGG + Intergenic
1107195663 13:37648347-37648369 ACAATATGTCCTTTTCATTTTGG + Intronic
1108076571 13:46686225-46686247 ACAATTTCCCCTGTATCTTTGGG - Intronic
1108111721 13:47081002-47081024 TCAATATGCCCTTTTTTTTCTGG + Intergenic
1109595527 13:64548930-64548952 ACAGTTTTCCCTGTTTCTTTGGG + Intergenic
1110623861 13:77629720-77629742 ACAATTTCCCCTGTATCTTTGGG - Intronic
1111046221 13:82816138-82816160 ACAATTTCCCCTGTATCTTTAGG + Intergenic
1112462214 13:99613195-99613217 CCAGGGAGCCCTTTTTCTTTTGG - Intronic
1112505618 13:99973205-99973227 AGAATGTGATCTTTTTCTTTGGG + Intergenic
1113703017 13:112401410-112401432 ACAATTTCCCATTTTCCTTTAGG + Intronic
1114070718 14:19103684-19103706 ACATTGTGCCATTTTTCTTGTGG - Intergenic
1114091543 14:19296322-19296344 ACATTGTGCCATTTTTCTTGTGG + Intergenic
1114731816 14:25000930-25000952 ACAATTTCCCCTCTATCTTTGGG + Intronic
1115167354 14:30463899-30463921 ACAATTTTCTCTCTTTCTTTGGG + Intergenic
1116037302 14:39642871-39642893 TCCATGTGGCCTTTCTCTTTTGG + Intergenic
1116666087 14:47777469-47777491 ACAGTTTTCCCTGTTTCTTTGGG + Intergenic
1117836142 14:59808225-59808247 TCAAGGTGGTCTTTTTCTTTAGG - Intronic
1118757432 14:68855054-68855076 ACAAATTTCCCTGTTTCTTTGGG - Intergenic
1119166822 14:72501508-72501530 AGAATTTACTCTTTTTCTTTAGG - Intronic
1119752236 14:77087726-77087748 ACAATTTTCCCTGTATCTTTGGG - Intergenic
1119864637 14:77963105-77963127 ACAATTTCCCCTGTATCTTTGGG + Intergenic
1120075134 14:80147542-80147564 ACAATGTGCCCTCTATCATCGGG - Intergenic
1120699405 14:87681977-87681999 AAAACGTGCACTTTTTCTTCTGG - Intergenic
1121506447 14:94481425-94481447 CCAAGGTGCCCTTTCTCTTTGGG - Intergenic
1122141380 14:99664879-99664901 ACAATTTCCCCTGTATCTTTGGG - Intronic
1123190512 14:106565060-106565082 ACAATGTGCTCTTTATCTGGGGG + Intergenic
1125859143 15:42981346-42981368 CAAATGTGCCCTGTGTCTTTTGG + Intronic
1125887607 15:43240394-43240416 ACAATTTCCCCTGTATCTTTGGG + Intronic
1126349653 15:47731120-47731142 ACACTTTGCCCTTTTCTTTTGGG + Intronic
1126454728 15:48848884-48848906 ACCATGTCCCCTTTTTCTAGTGG + Intronic
1126700654 15:51363986-51364008 GGAATGTGCCATTTTTCCTTTGG + Intronic
1126730713 15:51679786-51679808 ACAAAATACCCTTTTTCTTTTGG + Intergenic
1127332667 15:57954141-57954163 ATAATGTGCCCTGTATCTATTGG - Exonic
1127376807 15:58392615-58392637 ACAATTTCCCCTGTATCTTTGGG - Intronic
1127520689 15:59740428-59740450 ACACTGTGCTCTTATGCTTTTGG + Intergenic
1130556627 15:84927337-84927359 ACAATTTTCCCTGTATCTTTGGG - Intronic
1131433073 15:92402004-92402026 ATAATGTTCCTTTTTCCTTTGGG + Intronic
1131667589 15:94586865-94586887 ACAATGTACCCTTTGTATTAAGG + Intergenic
1132085390 15:98904413-98904435 ACAATGTTTCCTCTTTGTTTAGG - Intronic
1133578263 16:7116028-7116050 GCCATGTGCCCTTTCTCATTTGG + Intronic
1133791227 16:9010846-9010868 ACAAAATGACATTTTTCTTTAGG + Intergenic
1134150971 16:11804632-11804654 ACAAAGTACCTTTTTCCTTTGGG - Intergenic
1135203667 16:20463262-20463284 ACAATATTCTCTTTTTTTTTTGG - Intronic
1137310480 16:47252123-47252145 ACATTTTCCCCTATTTCTTTTGG - Intronic
1137381333 16:48002401-48002423 ACAATTTCCCCTGTATCTTTGGG - Intergenic
1140028896 16:71318242-71318264 AAAATGTGCCTCTTCTCTTTGGG + Intergenic
1141257184 16:82413477-82413499 AAAAAATGCCCTTTTTCTTTTGG - Intergenic
1141714499 16:85718989-85719011 ACAATTTTCCCTTATTCTATGGG + Intronic
1144117964 17:12119151-12119173 AGAATGTGCACTTTGTCTATGGG - Intronic
1145375805 17:22346912-22346934 ACTATGTGGCCTTTTTGTATTGG + Intergenic
1147337035 17:39732687-39732709 ACTATGTGGCCTTTTGCTTCTGG + Intergenic
1149273442 17:55008573-55008595 ACAGTTTTCCCTGTTTCTTTGGG - Intronic
1150049847 17:61950824-61950846 TCAGTGTCCCCTTTTTCTTAAGG - Exonic
1150927531 17:69549112-69549134 ACATTGAGCCCTTTATTTTTGGG + Intergenic
1151741055 17:75982305-75982327 ACAATTTCCCCTGTATCTTTGGG + Intronic
1151981394 17:77511860-77511882 AGAATGTACCCTTCTTCTATTGG + Intergenic
1152015565 17:77748300-77748322 ACAATTTCCCCTGTATCTTTTGG + Intergenic
1152825161 17:82459923-82459945 AGAATGTGCACATTTTCTTAAGG + Intronic
1153504501 18:5781890-5781912 ACAATTTCCCCTGTATCTTTGGG - Intergenic
1155340202 18:24806246-24806268 ACAATTTGCCCTATATATTTGGG - Intergenic
1155941144 18:31803474-31803496 ACAAGGTTCCCTTGTTCTTTGGG + Intergenic
1156035636 18:32764459-32764481 ACAATTTGCCCTTATTCTAGTGG - Intronic
1156596601 18:38554736-38554758 ACAAATTTCCCTTTTCCTTTGGG + Intergenic
1157729901 18:49994432-49994454 ACAATATACACTTTTACTTTAGG + Intronic
1158482743 18:57836284-57836306 AGAATTTGGCCTTTTTTTTTTGG + Intergenic
1158757704 18:60346774-60346796 ACAATGAACTCTTTTCCTTTGGG - Intergenic
1159788577 18:72746363-72746385 AAAATGTACCCTTTTTTATTTGG - Intronic
1160096398 18:75877614-75877636 ACATTTTCCCCATTTTCTTTGGG - Intergenic
1160476246 18:79191225-79191247 ATAATGTGTTATTTTTCTTTAGG + Intronic
1162679592 19:12330670-12330692 ACAATTTGTCCCTGTTCTTTGGG - Intronic
1162821292 19:13225110-13225132 AGCTTGTGCTCTTTTTCTTTGGG - Intronic
1163356393 19:16814368-16814390 ACAATGAGCGCCTTTTCTATAGG - Intronic
1164336328 19:24324607-24324629 ACAATCTGCCCATTTTATGTTGG + Intergenic
1164893566 19:31847158-31847180 ACAATGAGAACTTTTTTTTTTGG - Intergenic
1166162336 19:40964094-40964116 ACATTGTGCCTTTTTTTTTTTGG - Intergenic
1166578646 19:43870503-43870525 GTAATGTGTCCTTTTTCTCTGGG - Intergenic
1168467464 19:56614980-56615002 AGTATGTACCCTTTTTTTTTTGG + Intronic
1168501522 19:56897246-56897268 ACAAAATACCCTTTTCCTTTTGG + Intergenic
926310831 2:11674932-11674954 AGACTGTCCCCTTTATCTTTGGG - Intergenic
928077610 2:28279393-28279415 ATACTGTGCCATTTTTATTTAGG - Intronic
928484799 2:31718669-31718691 ACAATCTGCCACTTTTCTGTAGG - Intergenic
928578130 2:32677263-32677285 ACAATTTGTCGTTTTCCTTTTGG + Intronic
928906387 2:36372633-36372655 TCAATGTGCCCATTTTCTTAGGG + Intronic
929123567 2:38502962-38502984 ACAATTTCCCCTGTATCTTTGGG + Intergenic
929217722 2:39433902-39433924 ATCATATGCCCTTCTTCTTTTGG - Intronic
929324931 2:40598388-40598410 ACAAGGAGGCCGTTTTCTTTTGG - Intronic
929954453 2:46444778-46444800 ACAATATGCAGATTTTCTTTGGG - Intronic
930406877 2:50969877-50969899 ACAATTTCCTCTTTATCTTTGGG - Intronic
931163389 2:59718690-59718712 ACAATTTCCCCTGTTTCTTTGGG + Intergenic
931811557 2:65859265-65859287 GCAATCTGCCCTTCTTCTTCTGG + Intergenic
932033896 2:68220750-68220772 AAAATGTGGCCTTTTGTTTTTGG - Intronic
936290757 2:111222210-111222232 AAAATGTGCCCTCTGTCTTGAGG + Intergenic
936652948 2:114450686-114450708 ACAATGTGCTATTTCTCTTGAGG + Intronic
936941530 2:117889284-117889306 ACAATTGGCTCATTTTCTTTGGG + Intergenic
936982587 2:118277946-118277968 ACAATTTCCCCTGTATCTTTGGG + Intergenic
939515651 2:143164602-143164624 ACATTCTGTCCTTTTTCTCTGGG - Intronic
939764969 2:146236539-146236561 ACAATGTGCTCTTTTGATATAGG + Intergenic
939957204 2:148537117-148537139 ACAATTTAGCCTTTTTCTGTTGG - Intergenic
940361225 2:152798312-152798334 TCAAGGTGGTCTTTTTCTTTTGG + Intergenic
940427033 2:153541833-153541855 ACAATTTCCCCTGTATCTTTGGG + Intergenic
940952755 2:159694581-159694603 ACAATGTGACCTTTTATGTTTGG + Intergenic
941203587 2:162544530-162544552 ACTTTGTGCCCTTTCTGTTTTGG + Intronic
941306004 2:163868235-163868257 AGAATGATCCCTATTTCTTTGGG - Intergenic
941633118 2:167905746-167905768 ACAGCGTGCCCTTTTTCGATGGG - Intergenic
943024470 2:182610258-182610280 ACAATTTCCCCTATATCTTTGGG + Intergenic
943267785 2:185757810-185757832 AAAATGTTCCATTTTGCTTTAGG - Intronic
943490132 2:188542467-188542489 TCAATGTGATCTTTTTCTTAAGG - Intronic
943604061 2:189955449-189955471 ACAATGATGTCTTTTTCTTTGGG + Intronic
943662386 2:190573022-190573044 AAAATGTCCACATTTTCTTTTGG - Intergenic
944326203 2:198407320-198407342 ACACTATGCCCTATTTCCTTAGG + Intronic
944357423 2:198807915-198807937 AACATGTTACCTTTTTCTTTTGG - Intergenic
945582210 2:211609490-211609512 ACAATTTTCCCTGTATCTTTGGG + Intronic
946915379 2:224514994-224515016 ACTTTTTACCCTTTTTCTTTAGG - Intronic
946976159 2:225153853-225153875 ACAATAGTCCCTTTTTCTTCAGG + Intergenic
948092247 2:235303960-235303982 AAAATGTTCCCTTTTTCTTTTGG - Intergenic
1169267113 20:4173559-4173581 GGAATGTGCCCTCTTTCTGTTGG + Intronic
1169460110 20:5787037-5787059 ACAATTTCCCCTGTATCTTTGGG + Intronic
1170289424 20:14751742-14751764 TCAATTTTTCCTTTTTCTTTTGG + Intronic
1171527122 20:25822969-25822991 ACTATGTGGCCTTTTTGTATTGG - Intronic
1171549705 20:26032915-26032937 ACTATGTGGCCTTTTTGTATTGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172264713 20:33601026-33601048 ATAATGTTCCTTTTTTTTTTTGG - Intronic
1172430479 20:34887037-34887059 ATAATTTGGCCTTTTACTTTTGG + Intronic
1173693787 20:44988884-44988906 ATAATGTGCCCTTTTGTTTCTGG + Intronic
1174463832 20:50702015-50702037 ACAAACTGCCTTTTTTTTTTTGG + Intergenic
1174658034 20:52188065-52188087 GCAATGTGCCCCTTTTCTTCTGG + Intronic
1176458494 21:6933994-6934016 GCAATGTACCTTTTTTCTTCAGG - Intergenic
1176836667 21:13799087-13799109 GCAATGTACCTTTTTTCTTCAGG - Intergenic
1177068404 21:16469035-16469057 ACACTGAGCCCTTTTTCTTTTGG - Intergenic
1177680288 21:24359281-24359303 AAAATGTGCCATTTTATTTTGGG - Intergenic
1177732004 21:25039265-25039287 TCAATCTGTCCTTTTTCTTAGGG - Intergenic
1180489183 22:15826149-15826171 ACATTGTGCCATTTTTCTTGTGG - Intergenic
1182369169 22:29798973-29798995 ACACTGTGCCCTTGTTCCTGGGG - Intronic
1182508051 22:30799527-30799549 GCAAGTTGCCCTTTGTCTTTGGG - Intronic
1182568584 22:31218666-31218688 AAAATGTGATCTTTTTCTCTTGG + Intronic
1182986786 22:34726104-34726126 ACAATTTTCTCTTTGTCTTTGGG - Intergenic
1184124930 22:42480347-42480369 ACAATTTCCCCTGTATCTTTGGG + Intergenic
1184133135 22:42529760-42529782 ACAATTTCCCCTGTATCTTTGGG + Intergenic
949748211 3:7320330-7320352 ACAGGTTTCCCTTTTTCTTTTGG - Intronic
950694422 3:14687421-14687443 ACACTGTGCCTGTTTTGTTTAGG + Intronic
951245202 3:20332507-20332529 ACAATGTGACATAGTTCTTTGGG - Intergenic
951372006 3:21860861-21860883 ACAGTCTGCCCCTTTTCATTTGG - Intronic
951680531 3:25290065-25290087 AGAATGCTCCCCTTTTCTTTAGG + Intronic
952668587 3:35938202-35938224 ACAATGGGACTTTTTTTTTTTGG + Intergenic
953010956 3:39024891-39024913 ACAATTTCCCCTGTATCTTTGGG + Intergenic
954651337 3:52165363-52165385 ACAAGGTGCCAGTTTTCCTTAGG - Intergenic
954960775 3:54562979-54563001 ATAATGTGGTATTTTTCTTTAGG + Intronic
955489009 3:59463834-59463856 ACAATTTTCTCTGTTTCTTTGGG + Intergenic
955579504 3:60403798-60403820 ACAATTTCCCCTGTATCTTTGGG + Intronic
955950319 3:64237187-64237209 ACAATGTGCTCTTTTAGTTTTGG + Intronic
956260845 3:67339323-67339345 GAAATGTGTCCATTTTCTTTAGG - Intergenic
957315777 3:78574918-78574940 ACAAATTTCCCTGTTTCTTTGGG - Intergenic
957366874 3:79236392-79236414 ACAAAATGCCCTTGTTCATTTGG - Intronic
957656120 3:83078333-83078355 AAAATGTGGCTTTTCTCTTTTGG - Intergenic
957711716 3:83869014-83869036 ACAATGGTTTCTTTTTCTTTGGG + Intergenic
957986966 3:87584394-87584416 ACAAAGTGCCGTATTTCCTTTGG - Intergenic
958501909 3:94921868-94921890 GCTATGTGCCTTTTCTCTTTGGG + Intergenic
958911727 3:100001686-100001708 GCAATGTGTACTGTTTCTTTTGG - Intronic
959644979 3:108689128-108689150 ACATTGTCCCCTTCTTCTGTAGG - Intronic
959847335 3:111049297-111049319 ACAGTTTTCCCTGTTTCTTTGGG - Intergenic
960161590 3:114355943-114355965 ACACTGTGCATTTTTTATTTTGG - Intronic
960251606 3:115461583-115461605 ACAATTTCCCCTGTATCTTTAGG + Intergenic
961336330 3:126181887-126181909 GCACTGTCCCCTTGTTCTTTAGG + Intronic
961490102 3:127250292-127250314 ACAATAAGTCATTTTTCTTTAGG + Intergenic
962094362 3:132278109-132278131 GCAATTTCCCCTTTATCTTTGGG + Intronic
962887444 3:139640462-139640484 ACAAAGTGGCCTTTTTTATTAGG - Intronic
963067761 3:141277520-141277542 AAGAGGTGCTCTTTTTCTTTCGG - Intronic
964545200 3:157826851-157826873 ACATTGTGCGCTTTTCCTATGGG + Intergenic
964937863 3:162115358-162115380 ACAATGTGCAATCTTACTTTGGG - Intergenic
966272779 3:178128432-178128454 GCCATGTGCAATTTTTCTTTTGG - Intergenic
966365859 3:179186647-179186669 ACAATGAGCCCTATTTTTTTTGG + Intronic
967481138 3:189974685-189974707 ACAATGTGCTCTGTTCCTGTAGG - Exonic
967695116 3:192521937-192521959 ACAATGGGGACTTTTACTTTGGG + Intronic
967742347 3:193017224-193017246 ACAATGATTCCTTTTTCTTTAGG + Intergenic
969439250 4:7207684-7207706 AGAATGTGCCTTCTTTCTCTAGG + Intronic
969856961 4:10007748-10007770 ACAATTTGCCCTTTTCATTCCGG - Intronic
969929038 4:10612343-10612365 CCAATGTGTCCATTGTCTTTTGG - Intronic
970709171 4:18842318-18842340 AAAATGTGCCCTTTTTTATCTGG + Intergenic
970817663 4:20177328-20177350 AAAATATCCCCTTTTTGTTTTGG + Intergenic
971579767 4:28321405-28321427 ACTATTTCCTCTTTTTCTTTGGG - Intergenic
973549545 4:52019357-52019379 ATAATGTTCCTTTTTTTTTTGGG - Intergenic
973886463 4:55327079-55327101 GTAATTTGCCCTTTTTCTCTGGG + Intergenic
974467174 4:62272219-62272241 ACAATTTCCCCTGTGTCTTTGGG + Intergenic
974666345 4:64967615-64967637 ACAATCTCTCCTTTTTCATTTGG + Intergenic
974670483 4:65023834-65023856 AAAATGTGGCATTTTTCTTCTGG + Intergenic
975572158 4:75828598-75828620 ACACTGTCCCCTGTATCTTTGGG + Intergenic
975572861 4:75835935-75835957 ACAATGTCCTCTTTATCTTTGGG - Intergenic
975582903 4:75922628-75922650 ACAATGTCCCCTGTATCTTTGGG + Intronic
975799809 4:78048701-78048723 ACTATGTGCTCTTTTTTTTTTGG - Intergenic
976545413 4:86329693-86329715 ACAATTTGCCTTTCTTCCTTAGG + Intronic
976694845 4:87908317-87908339 AGAATGTGCCTTTTTGCTTGGGG - Intergenic
976993510 4:91400870-91400892 CCACTGTGCCCTTTTTTCTTAGG - Intronic
977100843 4:92813006-92813028 ATAATGTGCACTTTTACTTGTGG + Intronic
977316019 4:95448907-95448929 TCTAGGTGCCCCTTTTCTTTGGG + Intronic
977348471 4:95848181-95848203 CCAGTGAGCCCTTTTTCTTTTGG - Intergenic
978673094 4:111274989-111275011 AAAATGTTCCCTCTTTATTTGGG - Intergenic
978834192 4:113128141-113128163 AAAATGTGATCTTTCTCTTTGGG + Intronic
979062573 4:116082095-116082117 ATATTGTGCACTTTTTTTTTAGG + Intergenic
979186905 4:117808068-117808090 ACACTTTGCCCTGTATCTTTGGG + Intergenic
980270805 4:130581510-130581532 ACAATTTCCCCTCTATCTTTGGG + Intergenic
980828381 4:138099589-138099611 ACAGTCAGCCCTTTGTCTTTGGG - Intergenic
983461476 4:168029625-168029647 ACAATGAGACCTTTTTCTTTTGG - Intergenic
984012881 4:174391738-174391760 ACAATATGACATTTTTCCTTTGG + Intergenic
984372815 4:178888596-178888618 GCAATGTGGGCTTTTTTTTTTGG - Intergenic
985104926 4:186490798-186490820 ACAGTGTTCCCTGTTTCTTTGGG - Intronic
985979240 5:3448646-3448668 ACAAGGTGCATTTTTTTTTTAGG + Intergenic
986685379 5:10271534-10271556 ACAATTTCCCCTGTGTCTTTGGG + Intergenic
987202389 5:15590573-15590595 TCAATGTTCCCTTTTGCTTCTGG + Intronic
988295692 5:29358171-29358193 ACAATGTGATCTTTTTCATCTGG + Intergenic
988904144 5:35768643-35768665 ACATTGTACCCTTTTCCTTGTGG + Intronic
989427143 5:41309061-41309083 ACAATGTGCCCTTTTTCTTTAGG + Exonic
989558312 5:42822469-42822491 ACAATTTCCCCTGTATCTTTGGG + Intronic
990088128 5:52004119-52004141 ACAAAGGGCAGTTTTTCTTTGGG + Intergenic
990162320 5:52956058-52956080 ACAATGGCACTTTTTTCTTTTGG - Exonic
990394251 5:55359160-55359182 AAAATGTGTCCTTTTTGATTGGG - Intronic
990420967 5:55632921-55632943 ACAATTTCCCCTGTATCTTTGGG + Intronic
991234065 5:64373802-64373824 ACAATGTGAAATTTGTCTTTTGG - Intergenic
991325703 5:65429356-65429378 ACAGTTTTCCCTGTTTCTTTGGG + Intronic
992622703 5:78609757-78609779 ACAATAAGCACTTTCTCTTTTGG + Intronic
992962488 5:81970235-81970257 ACAATTTCCCCTGTATCTTTGGG + Intergenic
994250761 5:97534090-97534112 ACCAGGTGCCCCTTTTCTGTGGG + Intergenic
994599384 5:101882987-101883009 TAAATGTGCCATTTTTTTTTTGG + Intergenic
994661093 5:102655331-102655353 ACACTGTGGTCTTATTCTTTGGG - Intergenic
996438360 5:123460820-123460842 ACAATTTCCCCTCTATCTTTGGG - Intergenic
996584727 5:125072633-125072655 ACAATTTGCTTTTTTTCTGTAGG + Intergenic
997206333 5:132052403-132052425 ACAATGGGTCTTTTTTATTTTGG - Intergenic
998108685 5:139484743-139484765 ACAATTTGCCCTCTGTCTTTGGG + Intergenic
998240301 5:140436392-140436414 AAAATGTGAACATTTTCTTTGGG - Intronic
999886096 5:155924665-155924687 AGAATATGCCCTTCTGCTTTTGG + Intronic
999966729 5:156818473-156818495 ACAATTTCCCCTGTATCTTTGGG + Intergenic
1000051671 5:157568360-157568382 AGGATGTTCCCTTTTTCTATGGG + Intronic
1003289844 6:4771104-4771126 AGAATTTGCACTTTTTTTTTTGG + Intronic
1003817741 6:9861131-9861153 TCTATGTGCACTTTTACTTTTGG - Intronic
1003985160 6:11427965-11427987 ACAATTTTCCCTTTTTCTAAAGG + Intergenic
1004737943 6:18427001-18427023 ACAATGTGTCTCTTGTCTTTGGG + Intronic
1004802550 6:19166395-19166417 GGAAAGTCCCCTTTTTCTTTTGG - Intergenic
1005146668 6:22699351-22699373 CCAATGTTCCCTTTTGCTCTGGG - Intergenic
1005643781 6:27822118-27822140 ACAATTTCCCCTGTATCTTTAGG - Intergenic
1005652592 6:27898152-27898174 ACAATTTCCCCTGTATCTTTAGG + Intergenic
1006438427 6:34039036-34039058 TCGATGTGCCCGTTTTGTTTTGG - Intronic
1008153248 6:47982327-47982349 ACAATCTGCTCTTTTTCTCTGGG + Intronic
1008377037 6:50803761-50803783 ACAATATCCCCTCTTTCTTCTGG - Intergenic
1008982368 6:57499624-57499646 ACACGTTTCCCTTTTTCTTTCGG + Intronic
1009766548 6:68084599-68084621 ACATTGTACAATTTTTCTTTGGG - Intergenic
1011011243 6:82705871-82705893 ACAATTTCCCCGTTTTCTTGGGG + Intergenic
1011837397 6:91450345-91450367 ACAATTTTCCCTATGTCTTTGGG + Intergenic
1012005368 6:93707445-93707467 ACAATTTCCCCTTTCTCTTTGGG - Intergenic
1012657938 6:101849257-101849279 ACCCTCTGCCCTTTTTCGTTGGG - Intronic
1012807345 6:103911106-103911128 ATAATAAGCCCTTTTTCCTTTGG - Intergenic
1012911412 6:105122030-105122052 AGAATGTGACATTTTTCATTTGG + Intronic
1014089935 6:117392691-117392713 ACAATGTGTCCATTTCATTTGGG + Intronic
1014758564 6:125329131-125329153 ACACTTTGCCCTTTTTCCATGGG - Intergenic
1014832822 6:126122734-126122756 ACAATTTCCCCTATATCTTTGGG + Intergenic
1016338738 6:143037646-143037668 ATAATGTGTCTTTTTTCTTCTGG + Intergenic
1017232157 6:152084655-152084677 AAAATGTGTTCTTTTTGTTTTGG - Intronic
1018274793 6:162119139-162119161 AAAAAGTGTGCTTTTTCTTTGGG - Intronic
1019822339 7:3254488-3254510 ACAATTTTCCCTGTATCTTTAGG - Intergenic
1020552411 7:9623042-9623064 AATATGTGCCTTTTTTCTTCTGG - Intergenic
1021365925 7:19777588-19777610 CTAATGTGTCCTTTTTCTTTTGG - Intergenic
1021556260 7:21921770-21921792 AGAATTTTCCCTTTTTTTTTTGG - Intronic
1023198157 7:37664754-37664776 TGAATGTGCCCCTTTGCTTTTGG + Intergenic
1023936936 7:44747095-44747117 ACTCTGTGCTCTATTTCTTTTGG - Intergenic
1024138735 7:46439384-46439406 ACAGTGTGCCCTTTTTTCTCTGG + Intergenic
1024210910 7:47202781-47202803 TCAATGAGCTCTTTTTGTTTTGG + Intergenic
1025133489 7:56391266-56391288 CCAATGTCCTTTTTTTCTTTAGG - Intergenic
1026472191 7:70703094-70703116 ACCATATGACCTTATTCTTTAGG + Intronic
1027262462 7:76474833-76474855 ATACTTTTCCCTTTTTCTTTTGG + Intronic
1027313838 7:76972925-76972947 ATACTTTTCCCTTTTTCTTTTGG + Intergenic
1027751995 7:82161025-82161047 ACAAGGTGCCCTGTTTCTTTGGG - Intronic
1027912441 7:84268534-84268556 AGTATTTTCCCTTTTTCTTTAGG + Intronic
1028275483 7:88851377-88851399 AAAATGTGTCTTTTTTCCTTTGG - Intronic
1028310612 7:89329190-89329212 ACAATGTGCCCGTATTGTTATGG + Intronic
1028312030 7:89350730-89350752 AAAATGTGCACACTTTCTTTGGG - Intergenic
1030878123 7:114841605-114841627 ACAAGTTTCCCTTTATCTTTGGG - Intergenic
1031099284 7:117459467-117459489 AAAATGTCCCCTTTTATTTTGGG + Intergenic
1031172765 7:118312658-118312680 ACAATTTCCCCTGTATCTTTGGG - Intergenic
1031620810 7:123931600-123931622 ACAATTTCCCCTCTGTCTTTGGG + Intronic
1031774812 7:125894728-125894750 ACAATTTTTCCTGTTTCTTTGGG + Intergenic
1031947418 7:127856794-127856816 AAAATGATCCCTTTTTCATTGGG - Intronic
1032304264 7:130717878-130717900 ACAATGTTACTTTTTTGTTTTGG + Intergenic
1033832902 7:145275188-145275210 ACAATGATTTCTTTTTCTTTGGG + Intergenic
1035810767 8:2489214-2489236 ACAATTTCCCCTATATCTTTGGG + Intergenic
1035885183 8:3283842-3283864 ACAATTTTCTCTCTTTCTTTGGG + Intronic
1037059518 8:14489291-14489313 ACAATTTGGCATATTTCTTTCGG + Intronic
1037350299 8:17946795-17946817 ATAATGTGCTCCTTTTCTGTAGG + Intronic
1039328352 8:36509637-36509659 ACAATCTCCCCTGTATCTTTGGG + Intergenic
1039569513 8:38575800-38575822 ACAATATCCCCTGTATCTTTGGG + Intergenic
1040761229 8:50847455-50847477 ACAAGGTATCCTTTCTCTTTCGG + Intergenic
1041842423 8:62287746-62287768 AGAATGTGCACTTTTTCTGTAGG - Intronic
1042013858 8:64284659-64284681 ACAGTTTTCCCTGTTTCTTTGGG + Intergenic
1042240179 8:66655995-66656017 ACTATGAACGCTTTTTCTTTTGG + Intronic
1043537316 8:81220020-81220042 ACAATGACTTCTTTTTCTTTGGG + Intergenic
1044300858 8:90581369-90581391 ACACTGCGCCTTCTTTCTTTTGG - Intergenic
1046256410 8:111702302-111702324 ACAATGTTCCTTTGTGCTTTTGG - Intergenic
1046943420 8:119953221-119953243 ACAATTTCCCCTGTATCTTTGGG - Intronic
1047096526 8:121632161-121632183 AAAATGTGCCTTTTGCCTTTTGG - Intronic
1047324152 8:123820254-123820276 AAAAAGTGGCCTTTTTCTTTTGG - Intergenic
1047351655 8:124080118-124080140 ACAATGTTCCATTGTTCATTTGG - Intronic
1050067644 9:1777500-1777522 AGAATGTTGCCTATTTCTTTTGG - Intergenic
1052067149 9:24036047-24036069 AAAATCTGCCCTTTTCTTTTAGG - Intergenic
1052222404 9:26043178-26043200 ACATTGTGCAATTTTTCCTTAGG + Intergenic
1053795059 9:41719072-41719094 ACTATGTGGCCTTTTTGTATTGG - Intergenic
1053872426 9:42506347-42506369 ACAATGTCCCCTTTATCGCTTGG + Intergenic
1053900328 9:42789567-42789589 ACAATGTCCCCTTTATCGCTTGG - Intergenic
1054150112 9:61595752-61595774 ACTATGTGGCCTTTTTGTATTGG + Intergenic
1054183470 9:61931135-61931157 ACTATGTGGCCTTTTTGTATTGG - Intergenic
1054239120 9:62593985-62594007 ACAATGTCCCCTTTATCGCTTGG - Intergenic
1054261310 9:62868031-62868053 ACAATGTCCCCTTTATCGCTTGG + Intergenic
1054469878 9:65526856-65526878 ACTATGTGGCCTTTTTGTATTGG + Intergenic
1054553251 9:66628507-66628529 ACAATGTCCCCTTTATCGCTTGG - Intergenic
1054655037 9:67657339-67657361 ACTATGTGGCCTTTTTGTATTGG + Intergenic
1056133302 9:83606466-83606488 GCACTGTGCCCCTTGTCTTTGGG - Intergenic
1057037305 9:91820716-91820738 AGAATGTGACCTTATTCTTTAGG + Intronic
1057243541 9:93434457-93434479 ACAACATGCTCTTTTTTTTTCGG + Intergenic
1057577253 9:96253029-96253051 ACCATGTCCCATTTTTATTTGGG - Intronic
1057732298 9:97620975-97620997 ACATTTTCCCCTTTGTCTTTGGG - Intronic
1060363490 9:122984091-122984113 ACATTTTTCCCTTTTTCTTAAGG + Intronic
1060455324 9:123787770-123787792 AAAAGGTGCCCTTTCTCTTAAGG - Intronic
1060671779 9:125476123-125476145 ACACTGTGGGCTTTTTCTTAAGG - Intronic
1060715235 9:125920449-125920471 CCAATGTGTCCATTTCCTTTTGG - Intronic
1061117106 9:128620783-128620805 AAAATGTGTCGTTTTTGTTTGGG + Intronic
1185887509 X:3796137-3796159 GCAATGTGCTCTCTTTCCTTTGG + Intergenic
1186213394 X:7273695-7273717 TCAATTTCCCCTTTATCTTTGGG + Intronic
1186218553 X:7325705-7325727 ACAATTTCCCCTGTATCTTTGGG - Intronic
1187186839 X:16994991-16995013 AACATTTGCCATTTTTCTTTTGG - Intronic
1187238193 X:17487860-17487882 TCAATCTGCACTTTTTATTTTGG - Intronic
1187842353 X:23501802-23501824 ACAATTTCCCCTGTATCTTTGGG + Intergenic
1188369285 X:29349073-29349095 ACAATTTCCCCTGTGTCTTTGGG - Intronic
1188600543 X:31958378-31958400 GAAATGAGCCCTTTTTATTTGGG - Intronic
1189613752 X:42764218-42764240 TCAATGTGCTCTTTTTCATCAGG - Intergenic
1190143681 X:47870982-47871004 TCCATTTGCCCATTTTCTTTTGG + Intronic
1190384405 X:49870899-49870921 ACACAGTTCCTTTTTTCTTTGGG + Intergenic
1190706064 X:53029381-53029403 ACAAATTGCCCTTGTTCTTGTGG + Intergenic
1192354430 X:70387162-70387184 ACTATGTGCCAATTTTATTTAGG + Exonic
1194721588 X:97346615-97346637 ACAAGTTTCCCTATTTCTTTTGG - Intronic
1194732472 X:97471979-97472001 ACAATGTTCCCTTTCACTTAGGG + Intronic
1196007892 X:110854847-110854869 ACAATGAGCTCTATTGCTTTTGG - Intergenic
1196306739 X:114111885-114111907 ACAATTTGCCCTGTATCTTTGGG - Intergenic
1196409928 X:115407597-115407619 ACATTCTGGCCTTTTTCTTGAGG + Intergenic
1196506547 X:116451097-116451119 ACAACGTGCCATTTTTTATTAGG - Intronic
1196521182 X:116674022-116674044 ACAATGTGCACTTTTCTATTTGG + Intergenic
1197533156 X:127655575-127655597 ACCATGTGCACTTTTTACTTGGG + Intergenic
1199043976 X:143147345-143147367 ACATTTTCCCCTTTGTCTTTTGG - Intergenic
1199073085 X:143501348-143501370 ACAATTTCCCCTGTATCTTTGGG - Intergenic
1199215642 X:145257408-145257430 ACAATTTCCCCTGTATCTTTGGG + Intergenic
1199225921 X:145373741-145373763 AGAATGTGCATCTTTTCTTTAGG - Intergenic
1200204171 X:154303946-154303968 ACGATGTGCCCTTTCTACTTTGG - Intronic
1200285622 X:154819608-154819630 GCAAAATGCCCTTTCTCTTTGGG + Intronic
1200375102 X:155771664-155771686 ACAATGTGTCCTTTTTTATTTGG + Intronic
1200745034 Y:6896799-6896821 ATAATGTGTCCTTTTTCTCTTGG - Intergenic
1200905739 Y:8480342-8480364 GCATCGTGCCCTTTTTCTCTGGG + Intergenic
1202341899 Y:23878475-23878497 TCACTGTGACCTTTATCTTTTGG + Intergenic
1202528868 Y:25791611-25791633 TCACTGTGACCTTTATCTTTTGG - Intergenic