ID: 989428816

View in Genome Browser
Species Human (GRCh38)
Location 5:41327956-41327978
Sequence CCACTGTGCTTGGCAGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 371}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989428805_989428816 21 Left 989428805 5:41327912-41327934 CCTCCTGCTTCAGCCTCCCAAAG 0: 1337
1: 29251
2: 84105
3: 163898
4: 171852
Right 989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG 0: 1
1: 0
2: 3
3: 39
4: 371
989428806_989428816 18 Left 989428806 5:41327915-41327937 CCTGCTTCAGCCTCCCAAAGCGC 0: 31
1: 3539
2: 72209
3: 199639
4: 332618
Right 989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG 0: 1
1: 0
2: 3
3: 39
4: 371
989428811_989428816 5 Left 989428811 5:41327928-41327950 CCCAAAGCGCTGGGATTACAGGC 0: 2178
1: 223513
2: 277731
3: 230911
4: 270282
Right 989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG 0: 1
1: 0
2: 3
3: 39
4: 371
989428809_989428816 8 Left 989428809 5:41327925-41327947 CCTCCCAAAGCGCTGGGATTACA 0: 2992
1: 297958
2: 272622
3: 210278
4: 227214
Right 989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG 0: 1
1: 0
2: 3
3: 39
4: 371
989428812_989428816 4 Left 989428812 5:41327929-41327951 CCAAAGCGCTGGGATTACAGGCC 0: 50
1: 7283
2: 231003
3: 283568
4: 271711
Right 989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG 0: 1
1: 0
2: 3
3: 39
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989428816 Original CRISPR CCACTGTGCTTGGCAGATGC TGG Intronic
900353853 1:2250389-2250411 CCACTGTCCATGGCTGATGGAGG + Intronic
900375087 1:2350596-2350618 CCACTGTCCATGGAAGAGGCTGG - Intronic
900664761 1:3807755-3807777 CCACTGTGCCTGGCTGAGACTGG + Intergenic
900720479 1:4172571-4172593 GTGCTGTGCTTGGCAGGTGCAGG + Intergenic
902042832 1:13505175-13505197 CCGCTGTGCTTAGCAGAGGAGGG + Intronic
902601219 1:17540917-17540939 GCACAGTGCTGGGCGGATGCTGG - Intronic
902718148 1:18286892-18286914 CCACTGTGCCTGGCCGAAGATGG - Intronic
905217223 1:36417365-36417387 CCACTGTGCCCGGCCTATGCTGG + Intronic
905595154 1:39200409-39200431 CCACTGTGCCTGGCCCAGGCTGG - Intronic
905815890 1:40950574-40950596 CCACTGTGCCTGGCTGAGGAAGG + Intergenic
906207972 1:43997135-43997157 CAAATGTGCCTGGCAGAGGCTGG + Intronic
906211502 1:44014724-44014746 GCCCTGGGCTTGGCAGAGGCGGG + Intronic
906590489 1:47020571-47020593 CCCCTGTGCTGGGCACATGCTGG - Intergenic
908518748 1:64919939-64919961 GCCCTGTGCTTAGCAGGTGCTGG - Intronic
908646711 1:66286389-66286411 CCTGTGGCCTTGGCAGATGCAGG + Intronic
911282824 1:95952505-95952527 CCACTGTGCCTGGCCCATTCTGG + Intergenic
912406419 1:109442134-109442156 CCTCTGTCCTTGGAACATGCTGG + Intergenic
912929074 1:113940090-113940112 CCACTGTGCCTGGCCCATACTGG + Intronic
913001464 1:114584660-114584682 CCACAGTGCATGGCACATGGTGG + Exonic
914706162 1:150171624-150171646 CCACTGTGCTTGGCAGAGAAGGG - Intergenic
916139761 1:161685407-161685429 CCACTGTGCCTGGGTGATCCTGG - Intergenic
916147103 1:161749864-161749886 CAGCTGTGCCGGGCAGATGCTGG + Exonic
916417697 1:164608215-164608237 GCACAGTACTTGGCACATGCTGG - Intronic
916859987 1:168793213-168793235 CCACTGTGCCTTGCACATGTAGG - Intergenic
916884271 1:169051961-169051983 CTATTGTGCATGGCAGAGGCTGG + Intergenic
917203786 1:172546619-172546641 CCACTGTGCCTGGCCTATACAGG - Intronic
917564353 1:176196750-176196772 CCACTGTGCCTGGCCAGTGCTGG - Intronic
917626967 1:176856046-176856068 CCACCGTGCCTGGCACAGGCTGG - Intergenic
917668572 1:177249788-177249810 CCTCTGAGGTTTGCAGATGCTGG + Intronic
919043415 1:192421859-192421881 ACACTGTGCATCACAGATGCTGG + Intergenic
919660083 1:200235885-200235907 CCACTGTTCTAGGCACATGAGGG - Intergenic
920047846 1:203145288-203145310 CCCCTGTGCTGGGCAGATTGGGG - Intronic
920363084 1:205432719-205432741 CCACTGTGCCTGGCTGAGGTGGG - Intronic
922295497 1:224246315-224246337 CCACTGTGCCTGGCCGAAGTGGG + Intronic
922814790 1:228440811-228440833 CCACTGTGCCTGGCTGAAGTCGG + Intergenic
923355654 1:233152711-233152733 CCATTGTGCTAGGCAGTTGGTGG - Intronic
924386286 1:243501023-243501045 CCACTGGGGTTGACAGATCCAGG - Exonic
924698880 1:246429711-246429733 ACACTGTGCCTGGCATATGGTGG - Intronic
1062861298 10:812464-812486 CCAGTGGCCTTGGCAGAGGCAGG - Exonic
1063665893 10:8060385-8060407 CCACGGTGCCTGGCAGGGGCTGG + Intronic
1065467928 10:26045136-26045158 CCACTTTGCTGGGCAGATGGTGG - Intronic
1065784018 10:29196377-29196399 CCTCTTTGCTTGGCAGGTCCTGG - Intergenic
1068238357 10:54268632-54268654 CCATTATGCTAAGCAGATGCTGG + Intronic
1068448926 10:57162034-57162056 CCACTGTGCCTGGCCAATGAGGG - Intergenic
1071152298 10:82649739-82649761 CCACTGCGCCTGGCTGGTGCAGG + Intronic
1072106880 10:92282961-92282983 CCACTGTGCCTGGCTGATTTAGG - Intronic
1072524273 10:96257753-96257775 ACACTGGGCATGGCACATGCAGG + Intronic
1073447646 10:103590961-103590983 CCACTGGGCATGGCAGCTGGGGG + Exonic
1075426378 10:122344819-122344841 CCTGTGGGCTTGGCAGATGTGGG + Intergenic
1075611469 10:123858141-123858163 CCTGTGTGGTTGGCAGATACAGG - Intronic
1076014037 10:127013591-127013613 CCAGTGAGCCTGGCAGAGGCAGG - Intronic
1076110747 10:127857246-127857268 CCATGGTGCCTTGCAGATGCTGG + Intergenic
1076575133 10:131460830-131460852 CCACTGAGCTATGCAGATGCAGG - Intergenic
1076679747 10:132165601-132165623 CCCCTGTGGTTGGCATGTGCTGG + Intronic
1076735409 10:132456799-132456821 CCGCAATGCTTGGCAGATGATGG + Intergenic
1076875353 10:133213164-133213186 CCAGAGTGCTGGGCAGAGGCAGG - Intronic
1077076677 11:705437-705459 CCACTGTGGTGGGCAGAGGTGGG + Intronic
1077636435 11:3844677-3844699 CCACTGGGCCTGACAGAGGCAGG + Intergenic
1077747549 11:4924076-4924098 CCACTGTGCTGGGCATTTTCTGG - Exonic
1078269974 11:9786146-9786168 CCACTGCGCCTGGCAGACACTGG + Intronic
1078536506 11:12179266-12179288 CTACAGTGCTGGGCAGAGGCAGG - Intronic
1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG + Intronic
1078937687 11:15965973-15965995 CCACTGTGGTTGGCAGTAGTTGG - Intergenic
1079402048 11:20113719-20113741 CCACTGTGCTGGGCTGGTCCTGG - Intronic
1080060188 11:27948837-27948859 CTACTGTGCTGGGCAGTAGCGGG + Intergenic
1080749653 11:35140076-35140098 CCACACTGATTGGCAGAAGCAGG - Intronic
1083927763 11:65818885-65818907 GCACTGTGCTAGGCAGATTCTGG - Intergenic
1084718442 11:70888924-70888946 CCACTGTGCTAGGCACGTGGTGG - Intronic
1088199658 11:107318142-107318164 CCACTGTGGTTGAAAGATACTGG + Intergenic
1088688520 11:112305149-112305171 CCACAGTGCTAGACAGATGGTGG - Intergenic
1089381014 11:118031848-118031870 CCACCATGCCTGGCCGATGCTGG - Intergenic
1089468384 11:118701086-118701108 CCACTGTGCCTGGCTGGTGGTGG + Intergenic
1089559811 11:119338145-119338167 CCACTGTGCTGGGCATAGCCTGG - Intergenic
1089635792 11:119810734-119810756 CCGCTGTGCCTGGCCCATGCTGG - Intergenic
1089680366 11:120115877-120115899 CCACAGTGCTTGGCACAAGTGGG - Intronic
1089992348 11:122873433-122873455 CCACTGTGCCTGGCATATAATGG + Intergenic
1090587381 11:128228689-128228711 CCACTGTGCCGGGCTGATTCAGG - Intergenic
1090865039 11:130692425-130692447 GCATTGTGCCTGGCAGATGTTGG + Intronic
1091929358 12:4382559-4382581 CCATCATGCTTGGCAGGTGCTGG - Intergenic
1092074450 12:5661616-5661638 CCACTGTGACAGGCAGAGGCTGG + Intronic
1092735820 12:11581511-11581533 CCACAGTGCCTGACACATGCTGG + Intergenic
1096267020 12:50131807-50131829 CCACTGTGCCTGGCTCATGGTGG - Intronic
1096806152 12:54142367-54142389 CCACTGTGCCTGGCCGAGCCTGG - Intergenic
1097202511 12:57291364-57291386 CCACTGTGCCTGGCAAAAGATGG - Intronic
1097689097 12:62717124-62717146 CCACTGTGCTTGGCCTAAACTGG + Intronic
1100507184 12:95233687-95233709 CCACTGTGCCTGGCCAATGTTGG + Intronic
1100738647 12:97566474-97566496 CCACTGGCCTTGGCACAAGCAGG + Intergenic
1101145671 12:101838406-101838428 CCACCGTGCCTGGCAGAAGCTGG - Intergenic
1101515442 12:105430653-105430675 CCACTGCACCTGGCAGATGGGGG - Intergenic
1103518414 12:121522142-121522164 CCACTGTGCCTGGCACAAGGTGG - Intronic
1103784237 12:123420310-123420332 CCACTGCGCCTGGCAGAGACGGG + Intronic
1103825070 12:123731583-123731605 ACACTTTGCTGGGCAGAGGCAGG - Intronic
1104547189 12:129723027-129723049 CCACTGTGCCCGGCCGATCCTGG + Intronic
1104788619 12:131467993-131468015 CCACTGTGCCTGGCCCAGGCAGG + Intergenic
1105941235 13:25149850-25149872 CCACTGCACTTGGCAGATTCCGG - Intergenic
1106008225 13:25791600-25791622 CCACTCTGCCTGGAAGTTGCTGG + Intronic
1106095456 13:26639552-26639574 TCTCTGTGCCTGGCAGAGGCAGG - Intronic
1106667668 13:31869689-31869711 CCACTGTACTTGTGAGATACTGG - Intergenic
1106954817 13:34924829-34924851 CCACTGTGGATTGCAGAGGCAGG + Intergenic
1107184635 13:37504674-37504696 CCACTGTGCCTGGCAAAGGAAGG - Intergenic
1107203490 13:37751823-37751845 TCACTTTGCTTGGGAGATACAGG - Intronic
1107528815 13:41262047-41262069 CCACTGTGCTCGGCACATTTTGG - Intronic
1107826516 13:44333300-44333322 GCACTGGGCTTGGCAGTGGCAGG + Intergenic
1108522069 13:51255628-51255650 CCACTGAGCATGTGAGATGCTGG - Intronic
1109584350 13:64378482-64378504 CCACAGTGCCTGGCTGATGTAGG - Intergenic
1111976286 13:94969340-94969362 ACACCGTGCTAGGCAGAAGCCGG + Intergenic
1112124486 13:96449247-96449269 CCACTGTGCCTGGCATAATCTGG + Intronic
1113713160 13:112484241-112484263 CATCTATGCTTGGCTGATGCTGG + Intergenic
1113818358 13:113191967-113191989 CCACTGTGCTTGGCTCATCGAGG - Intronic
1113881221 13:113627729-113627751 CCACTGTGAACGGCACATGCAGG + Intronic
1117065288 14:52007809-52007831 CTGCTCTGCTGGGCAGATGCAGG - Exonic
1118600200 14:67466703-67466725 CCACTGTGCCTGGCCCAGGCTGG - Intronic
1119494964 14:75070273-75070295 ATACTGTGCGTGGCAGAGGCTGG + Intronic
1119520511 14:75281104-75281126 CCACTGGGCCTGGATGATGCTGG - Exonic
1121277077 14:92675843-92675865 ACACTTTGCGTGGCAGATGGAGG - Intronic
1121664420 14:95661026-95661048 CCACAGAGCTTGGATGATGCAGG - Intergenic
1121720209 14:96104014-96104036 GCACTGTGCTAGGCTGATGAAGG + Intergenic
1121924606 14:97916162-97916184 CCACAGTGCTTGGGTGATGGAGG + Intergenic
1121968872 14:98338147-98338169 CCACTGAGCTTGGCCCATCCTGG - Intergenic
1122215619 14:100202001-100202023 GCACTGTGCTGGGCAGGTTCCGG - Intergenic
1122269988 14:100564724-100564746 CCACAGTGCCTGGCAGAGGCTGG - Intronic
1122574378 14:102732456-102732478 GCACGGTGCTTGGGAGCTGCAGG - Intergenic
1122652387 14:103232692-103232714 CCACTGGGCCTGGCACAGGCAGG - Intergenic
1122873287 14:104651126-104651148 CCACTGTGCCCGGCAGATGCTGG - Intergenic
1122981755 14:105195272-105195294 CCACTGTGCCTGGGAGCTGGAGG + Intergenic
1123139436 14:106061109-106061131 CCACGGTGGATGGCAGATGCAGG + Intergenic
1124355649 15:28993044-28993066 GTGATGTGCTTGGCAGATGCAGG + Intronic
1125309444 15:38362577-38362599 CCATTGTGCTTAGCAAATGCTGG + Intergenic
1125420358 15:39498667-39498689 GGACTGTCCTTGGCACATGCTGG - Intergenic
1128989246 15:72245073-72245095 CCACTGTGCCTGGCCCATGGGGG - Intronic
1129125828 15:73440660-73440682 GATCTGTTCTTGGCAGATGCTGG + Intergenic
1129160887 15:73747113-73747135 GAAGTGTGCTTGGCATATGCAGG - Intronic
1129168267 15:73791707-73791729 CCACTCAGCCTGGAAGATGCAGG - Intergenic
1129245919 15:74278554-74278576 CTTCTGGCCTTGGCAGATGCTGG + Intronic
1129629809 15:77246292-77246314 CCACTGTGCCTGGCCCCTGCTGG + Intronic
1130024006 15:80255327-80255349 CCACAGTGCTGGGCCGATGCAGG + Intergenic
1130320107 15:82834321-82834343 CCACCGTGCCTGGCTGATGCTGG + Exonic
1130746778 15:86662965-86662987 CCAGTGTTCTTGGAAGATGATGG - Intronic
1131036485 15:89225895-89225917 CCACTGTGCTGGGCACAGACAGG - Intergenic
1131199066 15:90381093-90381115 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1132146991 15:99435031-99435053 CCACTTTGCTTGGGAGAAGGGGG - Intergenic
1132235228 15:100215103-100215125 GCACTGTGCCTGGCAGGTTCCGG + Intronic
1132499208 16:277357-277379 CCACTGTGCCTGGCCGATTTTGG + Intronic
1132637439 16:959000-959022 CCACTGTGGATGGCAGACGGTGG + Intronic
1133124205 16:3634513-3634535 CCACTGTGCCTGGCCGAGACAGG + Intronic
1134179090 16:12033140-12033162 CCACTGTGCCCGGCCAATGCTGG + Intronic
1134241602 16:12510867-12510889 CCACGGTGCTTGGCACAGGCTGG - Intronic
1135246489 16:20861502-20861524 TCACAGTGCCTGGCACATGCTGG + Intronic
1135305831 16:21366886-21366908 CCACTGTGCCCGGCCAATGCTGG + Intergenic
1136048071 16:27631249-27631271 CCACTGTGCCTGGCCCATGGGGG - Intronic
1136291406 16:29274503-29274525 CCACTGTGCCTGGCAGCTGGGGG - Intergenic
1138566409 16:57836398-57836420 CCACTGTGCCTGGCCAGTGCAGG + Intronic
1139848279 16:69935562-69935584 CCAGCGTGCGGGGCAGATGCGGG + Intronic
1139962953 16:70728403-70728425 CCACTGGGCTGGGCAGGAGCTGG - Intronic
1141792631 16:86246919-86246941 CAACGGTGCTTGGCACATGTAGG - Intergenic
1142097280 16:88248422-88248444 CCACTGTGCCTGGCAGTTGGGGG - Intergenic
1142477282 17:196455-196477 CAGCAGTGCTTGGCACATGCAGG - Intergenic
1143122001 17:4613972-4613994 CCACCGTGCCTGGCCTATGCAGG - Intergenic
1143919252 17:10317952-10317974 CCACTGTGCCTGGCCGATTGGGG - Intronic
1144169369 17:12644742-12644764 ACACTGTGCTTTGCAAATTCAGG + Intergenic
1144628457 17:16857538-16857560 ACACTGTGCCTGGCACATGGTGG + Intergenic
1145160045 17:20568109-20568131 ACACTGTGCCTGGCACATGGTGG + Intergenic
1147606380 17:41775999-41776021 TGACTGTCCTTGGCAGGTGCCGG - Intronic
1148639712 17:49177706-49177728 CCACTGTGCCCGGCAGAATCTGG - Intergenic
1150286524 17:63957512-63957534 CCTCCCTGCTTGGCAGCTGCGGG - Exonic
1150979889 17:70129111-70129133 CCACTGGGCCTGGAAGCTGCGGG - Intronic
1152145775 17:78567895-78567917 GCACTGTGCCTGGTAGGTGCAGG - Intronic
1153395166 18:4611479-4611501 GCACTGTGCTTAGCATATGCTGG + Intergenic
1153652096 18:7249849-7249871 CAACTGGGCTTGGGAGATGCTGG - Intergenic
1155224202 18:23714230-23714252 CCACTGTGCCTGGCCTATTCTGG - Intronic
1156226857 18:35118123-35118145 CCTCTGTCCTTGGCAGGGGCAGG + Intronic
1156746459 18:40397645-40397667 CCATTGTGCCTGGCACATTCTGG - Intergenic
1157891656 18:51423814-51423836 CCACTGTGCCTGGCCTATTCTGG + Intergenic
1158867143 18:61648921-61648943 CCACTTTGGTGGGCAGAGGCAGG - Intergenic
1161009748 19:1954512-1954534 TCACTGGGCTGGGCAGGTGCAGG - Intronic
1161038372 19:2097548-2097570 CCACGGGGCTTGGCTGAGGCTGG + Intronic
1161527956 19:4769141-4769163 CCAGTCTTGTTGGCAGATGCAGG - Intergenic
1161683934 19:5693979-5694001 CCTCTGTGGCTGGCAGCTGCTGG - Intronic
1161774961 19:6255929-6255951 CCACCGTGCTTGGCCCAGGCTGG - Intronic
1161849811 19:6732442-6732464 CCACTCTGCTGGGCAGCTGGGGG - Intronic
1162054582 19:8055001-8055023 CCACTGTGCCTGGCTGATAGTGG - Intronic
1162578467 19:11513277-11513299 CACCTGTGCTGGGCAGATGCAGG + Exonic
1162938756 19:13995561-13995583 CCACTGCGCTTGGCCAAGGCCGG - Intronic
1162992109 19:14310187-14310209 TCACTGTGGTTGGCAGTTGTGGG - Intergenic
1163287181 19:16356032-16356054 CCACTCTGCTTTCCAGATGGGGG - Intronic
1164671472 19:30074485-30074507 CCACTGTGCTGAGGAGAGGCAGG - Intergenic
1164930939 19:32175413-32175435 CCACCGTGCCTGGCTGATGCTGG + Intergenic
1165161410 19:33818960-33818982 CTGCAGTGCTTGGCATATGCTGG - Intergenic
1165224847 19:34347512-34347534 CCACTGTGCCTGGCTGATGCTGG + Intronic
1165277989 19:34771600-34771622 CCAATGAGCTTGGCATGTGCAGG + Intronic
1165305669 19:35000956-35000978 CCACCGTCCTTGGCTGTTGCGGG + Intronic
1165727428 19:38122943-38122965 ACACAGTGCATGGCAGATGGTGG - Intronic
1166149477 19:40861793-40861815 CCACTGTGCCTGGCCAATGGAGG - Intronic
1166828930 19:45626771-45626793 CCACTGTGCTTATCACCTGCGGG - Exonic
1166946229 19:46398269-46398291 CCACTGTGCCTGGCTGACACTGG - Intergenic
1167094395 19:47366566-47366588 CCACTGTGCCTGGCTGACACTGG + Intronic
1167436592 19:49481978-49482000 CCACTGTTCCTGGCCCATGCTGG + Intronic
1168173833 19:54608578-54608600 CCACTGTGCCTGGCCGAAGATGG - Intronic
1168297720 19:55385600-55385622 TCACTGTGATTGGCATATGATGG - Intronic
925153414 2:1632882-1632904 GCACTGTGCCTGGCACATGGTGG + Exonic
925652636 2:6107631-6107653 CCACTGTGCTTACCTGGTGCCGG + Intergenic
925818822 2:7779170-7779192 CCACTGTGCCTGGCCTATTCTGG + Intergenic
926819298 2:16835067-16835089 CCACTGTGCCTGGCTTATCCTGG + Intergenic
927030882 2:19119431-19119453 GCACTGTCCTTGGCAGTTCCAGG + Intergenic
927512626 2:23653876-23653898 CCACCGTGCCTGGCCGAAGCTGG - Intronic
927544752 2:23942704-23942726 CCACCGTGCCCGGCTGATGCAGG + Intronic
927657287 2:24959959-24959981 CCACAGGGCCTAGCAGATGCAGG + Intronic
929238909 2:39633521-39633543 CCACTGCACGTGGAAGATGCTGG + Intergenic
930102686 2:47615495-47615517 CCACTGTGCAGGGCACATGGTGG - Intergenic
930272703 2:49275500-49275522 CCACAATGTTTGGCAGATCCTGG + Intergenic
930879685 2:56257217-56257239 CCACTGTGTTGGGGAGATGGTGG + Intronic
931396174 2:61889852-61889874 GCACTGTGCTTAGCAGATAACGG - Intronic
932224602 2:70029712-70029734 CCACTTTGCTTGTCAGAAGCAGG + Intergenic
934107971 2:88713598-88713620 CCAGTGTGCTGGGCACTTGCTGG + Intronic
934563743 2:95326999-95327021 CCACAGTGCTCGGCACGTGCCGG + Intronic
937892595 2:126950099-126950121 CCACTGTGCTTGGCCGAGACAGG - Intergenic
945843318 2:214914113-214914135 GCACTGTGGGTGGCAGAGGCGGG - Intergenic
947314658 2:228842892-228842914 TCACTGTGCCTGGCCAATGCAGG - Intergenic
947491061 2:230594523-230594545 TCTCTGTGCTTGGCAGAGTCAGG - Intergenic
947505469 2:230705107-230705129 CCACTGTGCCTGGCAAAGCCTGG + Intergenic
947795170 2:232890014-232890036 CCCCTCTGCCTGACAGATGCTGG - Intronic
947899304 2:233707079-233707101 CCACTTTGCATGGCAGCTGAGGG + Intronic
948057577 2:235020096-235020118 CCACTGAGCTGGGCAGACTCTGG + Intronic
948255192 2:236563297-236563319 ACACTGTGCTTGGCGCGTGCCGG - Intergenic
948334999 2:237200792-237200814 CAACTTTGCTTGCCAGGTGCCGG + Intergenic
948738952 2:240030431-240030453 CCTCTGTGCTTGGGAGCTGCAGG + Exonic
948741027 2:240046074-240046096 CCTCTGTGCTTGGGAGCTGCAGG + Intergenic
1169012443 20:2261682-2261704 CCACTGTGCTTGTCAAATGAGGG - Intergenic
1169794515 20:9447338-9447360 CCAGTTTGGTTGGCAGATGGGGG + Intronic
1169859945 20:10140873-10140895 CCACTGTACTTGGCAGACAGAGG - Intergenic
1170436801 20:16338686-16338708 CCATTCTGCTGGGCAGGTGCAGG - Intronic
1170737194 20:19022315-19022337 TCCCTGTGCTTGGCTCATGCTGG + Intergenic
1171004793 20:21453946-21453968 ACAATGTGCTTGGGAGTTGCTGG + Intergenic
1171089478 20:22270393-22270415 ACACTGTGCTTGGAAATTGCTGG + Intergenic
1172008441 20:31832776-31832798 CCACTGTGCCTGGCTGAGGTGGG + Intronic
1172019077 20:31900045-31900067 CCACTGTGCCTGGCCGAATCTGG + Intronic
1172299729 20:33840566-33840588 CCCCTGCCCTTGGCTGATGCTGG - Intronic
1172494863 20:35373389-35373411 CCACTGTGCCTGGCCCATTCTGG - Intronic
1174306188 20:49615836-49615858 TGGCTGTGCTTGGCAGCTGCTGG - Intergenic
1174664363 20:52243711-52243733 CCACCGTGCCTGGCAGATGTTGG + Intergenic
1179723441 21:43328990-43329012 GCACTTTGCTTGGCAGCTTCAGG + Intergenic
1179887463 21:44320312-44320334 CCACTGTGGCTGGCAGGTCCCGG + Intronic
1179934035 21:44591230-44591252 CCCCTGTCCTTCCCAGATGCTGG - Intronic
1180246591 21:46552402-46552424 CCACTGTGCTAGGAACATTCAGG + Intronic
1181388429 22:22560855-22560877 CCACTGTGCCTGGCCAAGGCTGG + Intronic
1181456230 22:23061607-23061629 CCACTGTGCTGGGGAGAAGAGGG + Intronic
1182205438 22:28620062-28620084 CCACTGTGCCCGGCCGATGTTGG - Intronic
1182562417 22:31170938-31170960 CCACTGTGCCTGGCATGTGGGGG + Intronic
1183610053 22:38894866-38894888 CCACTGTGCCCGGCTGATCCTGG + Intergenic
1183961244 22:41413141-41413163 CCACCGTGCCTGGCCGAGGCTGG - Intergenic
1184159169 22:42687867-42687889 GCACTGTGATGGGCAGAGGCTGG - Intergenic
1184216553 22:43071202-43071224 CCACCGTGCTTGGCAACGGCAGG + Intronic
1184507910 22:44915431-44915453 ACAAGGTGCTTAGCAGATGCTGG - Intronic
1184632748 22:45796784-45796806 CCACTGTGCCTGGCCTATACTGG + Intronic
949584197 3:5422005-5422027 CCACTGAGTATGGCAGAGGCAGG + Intergenic
949592987 3:5513069-5513091 CCACTGCGCCTGGCCGATGATGG - Intergenic
951176379 3:19605774-19605796 CCACAGTGCCCGGCAGAAGCAGG - Intergenic
952455324 3:33466975-33466997 GCACTGTGAGTGGGAGATGCTGG + Intergenic
952666110 3:35906271-35906293 GCACAGTGCTTGGCACATGGAGG + Intergenic
953229676 3:41053480-41053502 GCACTGTGTCTGGGAGATGCAGG + Intergenic
953918876 3:46938213-46938235 CCACTGAGCTGGGCAGGTGCAGG - Intronic
954537391 3:51371447-51371469 ACACTGTGCTTGATAGATGTAGG - Intronic
954702961 3:52461353-52461375 CCACTGAGCTTGGCAGGGACAGG + Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955826694 3:62954793-62954815 CCACTGTGATTGGCTGAGACTGG + Intergenic
955873188 3:63461553-63461575 CCACTGTATTTCACAGATGCTGG - Intronic
956016101 3:64884702-64884724 CCACTGTTGTTGGCATCTGCAGG + Intergenic
956213460 3:66825259-66825281 CCACTGTGCCTGGCCCAAGCAGG + Intergenic
956742477 3:72286198-72286220 CCACTGTGCTTGCCAGATGATGG + Intergenic
957885775 3:86285683-86285705 CAACTCTGCTTGGCTGAGGCAGG - Intergenic
960562119 3:119096080-119096102 ACACTGTGCTAGGTAGTTGCTGG - Intronic
961139219 3:124541597-124541619 CCACTGTGCCCGGCCGATCCAGG - Intronic
961570901 3:127798146-127798168 GCACTGTGCTTGCAAGGTGCTGG - Intronic
961657391 3:128450775-128450797 CCACTGTGGCTGGCAGGTGGTGG - Intergenic
962403086 3:135078215-135078237 CCACTGTGCCTGGCAGGGGGAGG + Intronic
962496691 3:135946981-135947003 CCACTGTGCCTGGCCAATGAAGG - Intergenic
963227532 3:142877519-142877541 GCACAGTGCTTGGCACAAGCAGG - Intronic
963745455 3:149120117-149120139 CAGCTGTGTTTGGCAGTTGCAGG + Intergenic
964715876 3:159720829-159720851 GCACTTTGCTAGGCAGAGGCGGG - Intronic
966416421 3:179694260-179694282 CCACTGTGCCCGGCCGATTCTGG + Intronic
966542912 3:181111689-181111711 CCACTGTGCCTGGCTGATGGTGG - Intergenic
966798633 3:183741224-183741246 CCACTGTGCTTGGCCACAGCTGG + Intronic
967090181 3:186128288-186128310 CCACTGTGCCCGGCTGATGGTGG + Intronic
967469248 3:189843268-189843290 CCACTGGGCCTGGCAGGTGGTGG - Intronic
967557418 3:190876058-190876080 CCACTGTGCTTGGCTGACACTGG + Intronic
967877151 3:194275341-194275363 CCACTGTGCGGGGCAGAGGTGGG + Intergenic
969401636 4:6959528-6959550 ACACTGTGCTTCCCAGAGGCGGG - Intronic
969612841 4:8236724-8236746 CCACTCAGCCTGGCACATGCAGG - Intronic
969882471 4:10186434-10186456 CCAATGTGCTAAGCAGCTGCAGG - Intergenic
970008290 4:11430493-11430515 GCACTGTGCTTGGCTGCTGGTGG - Intergenic
970601092 4:17641742-17641764 GCACTTTGGTTGGCAGAGGCGGG - Intronic
971029279 4:22619601-22619623 CCACTGTGCCTGGCTGAGGAAGG + Intergenic
971361051 4:25939020-25939042 CCACTGTGTTTGGCAAGAGCTGG - Intergenic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
973019729 4:45187646-45187668 CCACTGTGCCTGGCTGCTCCTGG - Intergenic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
974075578 4:57165455-57165477 CCACTGTGCTTGGCCTATGAAGG + Intergenic
974409198 4:61517308-61517330 TCACTGTGCTTGCCACCTGCGGG - Intronic
974523617 4:63018604-63018626 CAAATGTGGTTGGCAGAAGCTGG + Intergenic
975907658 4:79233782-79233804 CCACTGTGGTTGGCTCATGATGG + Intronic
976133258 4:81907570-81907592 CCACTGCGCCTGGCCCATGCAGG - Intronic
976437038 4:85030024-85030046 CCACTGTGCCTGGCCTCTGCTGG + Intergenic
977751518 4:100614860-100614882 CCACTGTGCCTGGCCGAGGGTGG + Intronic
977813565 4:101386885-101386907 CCACCATGCCTGGCAGTTGCTGG + Intergenic
981774672 4:148351669-148351691 CAACTGTCCTGGGAAGATGCTGG - Intronic
982122073 4:152152278-152152300 CCACTGTGTTTGGAAGAGGCAGG + Intergenic
989120667 5:38001589-38001611 CCACTGTGCGTGAGAGATGGTGG - Intergenic
989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG + Intronic
989622704 5:43400470-43400492 CCACTGCGCCTGGCAGATTTTGG + Intronic
989958634 5:50384486-50384508 CCTGTGTGCTTTGCTGATGCAGG - Intergenic
994757608 5:103814525-103814547 CCTTAGTGCTTGGCAAATGCAGG - Intergenic
995291008 5:110453545-110453567 GCACTTTGCATGGCAGAGGCAGG - Intronic
998047273 5:138998453-138998475 CCACTGTGCTCAGCTGAGGCTGG + Intronic
998168502 5:139858210-139858232 TCACTGTGCTTCAGAGATGCTGG + Intronic
998515206 5:142747428-142747450 CCTCTGTGCTAGGCATGTGCTGG + Intergenic
998732798 5:145100001-145100023 TCACAGTGCTAGGCAGAGGCAGG + Intergenic
999012031 5:148053612-148053634 ACACAGTGCTAGGCAAATGCAGG + Intronic
1001557001 5:172643363-172643385 CCTCTGTGCTTGGCATGTGATGG + Intronic
1001907645 5:175486336-175486358 CCAGGTTGCATGGCAGATGCTGG - Intronic
1002282342 5:178138911-178138933 CCACTGTGCCTGGCAATTTCTGG - Intronic
1003045395 6:2728900-2728922 CCACGGTGGATGGCAGATCCTGG + Intronic
1003046594 6:2739164-2739186 CCACTGTGCCTGGCCGAAGTTGG - Intronic
1003097178 6:3151492-3151514 GAGCTGTGCTTGGAAGATGCTGG - Intronic
1005519513 6:26586932-26586954 CCACTTTGCGAGGCAGATGTGGG - Intergenic
1007384379 6:41510726-41510748 CCACTCTGCTTGTGAGAGGCGGG - Intergenic
1007721597 6:43888446-43888468 CCAGTGTCCTTGGCACAGGCAGG + Intergenic
1009266563 6:61562671-61562693 CCACAGTGATTGGAAGATGGGGG - Intergenic
1012458915 6:99437943-99437965 CCACTGAGCCTGGCCTATGCAGG + Intronic
1013318057 6:108960251-108960273 AGACTGTGCTTGGCAGAGACTGG - Intronic
1014676896 6:124378622-124378644 CCAGTGTGCTTGGGTGCTGCAGG - Intronic
1015257119 6:131190964-131190986 ATACTGTGCTTGGCACATACAGG + Intronic
1015279583 6:131418913-131418935 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1015577441 6:134687229-134687251 CCACTGTGCCCGGCCGATGATGG + Intergenic
1015792163 6:136974416-136974438 CAGCTGTGCTTGGCATATGGTGG + Intergenic
1015920553 6:138262477-138262499 CCACTGTGCCCGGCCAATGCAGG + Intronic
1016061747 6:139637674-139637696 CCACTGTGCTTGGCCTGAGCTGG + Intergenic
1016113179 6:140251292-140251314 CCACTGTGCCTGACTGATGTTGG + Intergenic
1017662782 6:156690190-156690212 CCAAAGTGCTTGGCACATCCTGG + Intergenic
1017740145 6:157399306-157399328 CCACAGTGCTGGGTAGATCCGGG + Intronic
1019644397 7:2121329-2121351 CCACGGTGCCTGGCAGGTGCTGG - Intronic
1020989880 7:15183456-15183478 CCACTGTTCTTGAAAAATGCAGG + Intergenic
1021967878 7:25939702-25939724 GCACTGTGCATGGCATATGGTGG - Intergenic
1022123818 7:27336540-27336562 CCACTGTGCCTGGCTAAAGCAGG - Intergenic
1023042924 7:36188081-36188103 CCACTGTGCCTGGCCTGTGCTGG + Intronic
1024333610 7:48180712-48180734 CCACCATGCGTGGCCGATGCTGG + Intronic
1024659848 7:51482956-51482978 CCACTGAGCCTGGCCGATGATGG + Intergenic
1025998686 7:66544561-66544583 CCACTGTGCCTGGCTGTAGCTGG - Intergenic
1026991642 7:74589408-74589430 CCACTGTGCCTGGCTGCAGCTGG - Intronic
1027124788 7:75548749-75548771 CCACTGTGCCTGGCAAATTCTGG + Intronic
1028419875 7:90620905-90620927 CCACTGTGATGGGCAGAAGTGGG - Intronic
1029158649 7:98535271-98535293 CCACTGAGCCTGGCTGATTCAGG + Intergenic
1029363720 7:100104228-100104250 CCACTGTGCCCGGCCGTTGCTGG - Intronic
1029525326 7:101090335-101090357 CCACTGCGCCTGGCAGAGCCTGG - Exonic
1029541009 7:101181956-101181978 CCACCGTGCCCGGCCGATGCAGG + Intergenic
1030947090 7:115737064-115737086 CCACTGTGCTTGGCCTATAGTGG + Intergenic
1031399418 7:121313852-121313874 CCACTGTGTTTGTCTGGTGCTGG + Intergenic
1032850249 7:135788871-135788893 CCACGGTGTTTGGCTGATTCTGG + Intergenic
1034634697 7:152557841-152557863 CCACTGTGCGTGCCGGTTGCCGG + Intergenic
1036082697 8:5574836-5574858 CTACTGTGCATAGCAGATGGGGG + Intergenic
1037942032 8:22958897-22958919 CCACTGTGTTTGTGTGATGCTGG - Intronic
1038628932 8:29222057-29222079 CCACTGTGCCTGGCATATATAGG - Intronic
1038650682 8:29400427-29400449 CCACTGTGCCTGGCCGAGGTAGG - Intergenic
1038751387 8:30299234-30299256 CCACTGTGCCTGGCCTAGGCTGG + Intergenic
1039088696 8:33805292-33805314 CCACAGTGCCTGGCCAATGCAGG + Intergenic
1039569396 8:38575021-38575043 GCACAGTACTTGGCAGATGGTGG + Intergenic
1039887508 8:41663618-41663640 CCTCTGTGCTGGGGAGAGGCAGG - Intronic
1041560772 8:59215528-59215550 CCTCTGAGCTTGGCAGAGTCAGG + Intergenic
1041775796 8:61521633-61521655 CCACAGTGAGTTGCAGATGCTGG - Intronic
1042028256 8:64446827-64446849 CCACTGGGTTTGGCTGATGATGG - Intergenic
1042140243 8:65670980-65671002 CCACTGTGCCTGGCAGAATATGG + Intronic
1043793861 8:84510521-84510543 CCACCGTGCCTGGCTGAAGCTGG - Intronic
1044574816 8:93756786-93756808 CCACTGTGCCTGGCCTATACAGG - Intronic
1045003571 8:97898632-97898654 CCACAGTGCCTGGCACATGGTGG - Intronic
1047262790 8:123276673-123276695 CCACAGTGCCTGGCATATACTGG - Intergenic
1047371264 8:124257940-124257962 CCACTGTGCCTGGCCAATGTGGG - Intergenic
1047852535 8:128874109-128874131 GCACTGTGCTTGGCACATAACGG - Intergenic
1048610018 8:136011980-136012002 TCACTTTGATTGACAGATGCTGG + Intergenic
1048680653 8:136837941-136837963 CCACAATGCTTGACAGATGAAGG - Intergenic
1048980078 8:139698521-139698543 CCACCCTGCTTAGCACATGCAGG - Intronic
1049243480 8:141550224-141550246 TCACCGTGCTTGGCAGATACAGG - Intergenic
1049250662 8:141587235-141587257 ACACTGTGCTGGGCACAGGCTGG + Intergenic
1049295190 8:141829414-141829436 CCACCGTGCTTGGCCCATGAGGG - Intergenic
1050119669 9:2295535-2295557 CCTCTGTGCTTTGCAACTGCAGG + Intergenic
1051146924 9:14036808-14036830 CCACTGTGCATGGCCCATGATGG - Intergenic
1051903980 9:22074148-22074170 CCACTGTGCTTGGCACCTAGAGG + Intergenic
1053163087 9:35827092-35827114 CCACCGTGCTTGGCCCCTGCTGG + Intronic
1056708992 9:88975573-88975595 CCACTGTGCCCGGCAGTTACTGG - Intergenic
1057610871 9:96542721-96542743 CCACTGCGCCCGGCAGAGGCCGG - Intronic
1061381020 9:130257691-130257713 CCACTGTGCCTGGCCAAAGCAGG - Intergenic
1061688173 9:132301372-132301394 CCACTGTGCCTGGCCTATTCTGG + Intronic
1185494007 X:540558-540580 CCACTGTGCCTGGCCCATGCAGG + Intergenic
1185705601 X:2264169-2264191 CACCTGTGCCCGGCAGATGCAGG + Intronic
1185705856 X:2265751-2265773 CACCAGTGCTTGGCAGACGCAGG + Intronic
1185705884 X:2265911-2265933 CACCAGTGCTCGGCAGATGCAGG + Intronic
1185705925 X:2266191-2266213 CACCAGTGCTTGGCAGACGCAGG + Intronic
1185705953 X:2266351-2266373 CACCAGTGCTCGGCAGATGCAGG + Intronic
1185705977 X:2266511-2266533 CACCAGTGCTCGGCAGATGCAGG + Intronic
1186247684 X:7631732-7631754 CCAAAGTGCTTGGAGGATGCTGG - Intergenic
1186882073 X:13876575-13876597 CCACTGTGCAGGGCAGATGGTGG + Intronic
1187211981 X:17240992-17241014 CATCTGTGCTTGGCATGTGCTGG + Intergenic
1188482314 X:30648519-30648541 CCACTGGGCTACGCATATGCTGG - Intergenic
1189066173 X:37811599-37811621 CCACTGTGCTTGGCAGAGAGCGG + Exonic
1189104095 X:38219637-38219659 GCAGTGTGCTTGGGAGATGTAGG - Intronic
1190042164 X:47080168-47080190 CCCCTGTGCCTGACAAATGCAGG + Intronic
1190580032 X:51883370-51883392 CCACTCTGCTTGGGAGAGACTGG - Intronic
1193262721 X:79427797-79427819 CCACTGTGCCTGGCCGGGGCTGG + Intergenic
1193266218 X:79472708-79472730 CCACTGGTCTTGGCAGCTGGGGG + Intergenic
1194018716 X:88659663-88659685 CCACCGTGCCTGGCCGTTGCTGG - Intergenic
1196306855 X:114113018-114113040 GCACTGTGCTTGGAACATACTGG + Intergenic
1196856477 X:119990032-119990054 TCACTGTGCTGGGCAGGCGCTGG - Intergenic
1197990354 X:132310862-132310884 CCACTGTGCCTGGCCAATGATGG - Intergenic
1200423191 Y:2994515-2994537 CCACTTTGCAAGGCAGAGGCAGG - Intergenic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic
1201326834 Y:12770026-12770048 GCACTTTGCTAGGCAGAGGCAGG - Intronic