ID: 989430563

View in Genome Browser
Species Human (GRCh38)
Location 5:41350217-41350239
Sequence TTCAATGAGAAAACAGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 702
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 644}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989430563_989430566 23 Left 989430563 5:41350217-41350239 CCGTCCTCTGTTTTCTCATTGAA 0: 1
1: 0
2: 3
3: 54
4: 644
Right 989430566 5:41350263-41350285 AAGCTAAATCTACAGCATAGAGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989430563 Original CRISPR TTCAATGAGAAAACAGAGGA CGG (reversed) Intronic
900004259 1:34355-34377 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
900023986 1:204871-204893 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
901561362 1:10074116-10074138 TTCATTGAGAAAACAGATGCAGG + Intronic
901874263 1:12158064-12158086 TTTATTGACAAAAAAGAGGAAGG + Intergenic
901957162 1:12794815-12794837 GTCAAAGAGATAATAGAGGAGGG + Intronic
901965177 1:12860593-12860615 GTCAAAGAGATAATAGAGGAGGG + Intronic
901980570 1:13030947-13030969 GTCAAAGAGATAATAGAGGAGGG + Exonic
902001518 1:13197984-13198006 GTCAAAGAGATAATAGAGGAGGG - Exonic
902020753 1:13343694-13343716 GTCAAAGAGATAATAGAGGAGGG - Intronic
902662785 1:17916970-17916992 TTCACTGAGCAGACAGAGGGAGG - Intergenic
902773091 1:18657468-18657490 TAGAAAGAGAAACCAGAGGAAGG + Intronic
904576668 1:31509365-31509387 TTCAGTGAGTCAACAGGGGAAGG - Intergenic
905478666 1:38246438-38246460 TTAAATGATAAAACGGAGGCAGG - Intergenic
905540617 1:38757527-38757549 TGCTATGGGAAAGCAGAGGAGGG - Intergenic
905960560 1:42038981-42039003 TGCCTTGAGAACACAGAGGAAGG - Intergenic
906041098 1:42788302-42788324 TTAAATGAGAAAACAGATCTGGG + Intronic
906402807 1:45518028-45518050 TCCAATAATAAAATAGAGGAGGG + Intronic
907635646 1:56132220-56132242 TTCACTGGCAAAATAGAGGATGG - Intergenic
907668778 1:56456450-56456472 TTAAATGAGAAAATATAGAAAGG - Intergenic
907957142 1:59240630-59240652 TTAAATGAGAAAATATATGAAGG - Intergenic
908587182 1:65582563-65582585 TTCACTGAGACAACAGAAGCAGG + Intronic
908643677 1:66253306-66253328 TGTAGTGAGAAAACAGAGAAAGG + Intronic
910354539 1:86340544-86340566 TTGAATGAGGAAAAAGAGGTAGG - Intergenic
910438886 1:87232114-87232136 TTCACTGAGAAAACTGAAGCAGG + Intergenic
910497682 1:87851104-87851126 TTGAGTGAGAAAACAGAGTTTGG + Intergenic
910611372 1:89146453-89146475 CTCAATGAAAAAACAAAGAAAGG + Intronic
910746243 1:90577971-90577993 TTCATAGAGAAAACAGAGCAAGG + Intergenic
910813973 1:91269634-91269656 TGCAATGGGAATGCAGAGGAAGG + Intronic
911592934 1:99768405-99768427 TTTAAAGAGAGAACAGAGAAAGG + Intergenic
911949106 1:104149446-104149468 TTCAGTGTGAAAACAGTGAAGGG + Intergenic
912513472 1:110203686-110203708 TTCAATGAGATAACACATGTTGG + Intergenic
912866791 1:113264769-113264791 TTCAAAGAGAAGCCATAGGAGGG - Intergenic
912926309 1:113916229-113916251 TTCAATGAGCACATTGAGGATGG - Intergenic
912987285 1:114446750-114446772 TCCAATTAAAAAACAGAGAAAGG + Intronic
913217433 1:116632108-116632130 TTCACTAAGAAATGAGAGGAAGG + Intronic
913219303 1:116646537-116646559 TTCATTGAGAAGGCAGAAGATGG + Intronic
913260780 1:116996181-116996203 TTCACTTAGAAAACAGGAGATGG + Intergenic
913484314 1:119319899-119319921 TGCTATGAAAATACAGAGGAAGG - Intergenic
913599295 1:120407450-120407472 TTCAGAGAGCAAACAGGGGATGG - Intergenic
914247021 1:145893772-145893794 ACCAATGGGAAAAGAGAGGAAGG + Intronic
914310530 1:146462039-146462061 TTCAGAGAGCAAACAGGGGATGG - Intergenic
914387405 1:147183590-147183612 TGTAATGAGAGCACAGAGGAAGG + Intronic
914591579 1:149111102-149111124 TTCAGAGAGCAAACAGGGGATGG + Intergenic
914955764 1:152160774-152160796 TTTAATGAGAAAGCAGAAGTAGG + Intergenic
915407189 1:155669547-155669569 TTCAAAGAGAATACATGGGAAGG + Intronic
915419942 1:155772279-155772301 TTCAAAGAGAATAGAAAGGAAGG + Intronic
915801619 1:158799627-158799649 TTTAATGAGAAAATAGACAAAGG + Intergenic
915811935 1:158922302-158922324 TAAATTGAGCAAACAGAGGATGG + Intergenic
916330819 1:163614562-163614584 GACAATTAGAAAACAGAGTAGGG + Intergenic
916355174 1:163897945-163897967 TTTTTAGAGAAAACAGAGGAAGG - Intergenic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916795532 1:168163622-168163644 TGCTATGAGAATACAGAGAAAGG - Intergenic
916964510 1:169922358-169922380 TGCATTGAGGAATCAGAGGAAGG - Intronic
917745703 1:178004820-178004842 TTCACAGAGATTACAGAGGAAGG + Intergenic
918001779 1:180503446-180503468 AGCAATGAGAGAACACAGGAAGG + Intergenic
918805928 1:189044469-189044491 TTCAGTTAGAAAAGAGAGGTTGG - Intergenic
919756515 1:201069465-201069487 TTCCATGAGAAATCAGGTGACGG - Exonic
920286166 1:204881367-204881389 TACAATCAGAAAAAAGAGGAGGG - Intronic
920793199 1:209112359-209112381 TTAAATGAGGAAAGGGAGGAAGG + Intergenic
921166311 1:212510175-212510197 TTCCATGCAAAAAGAGAGGAGGG + Intergenic
921294103 1:213685996-213686018 TTCAATGAGACCACACAGAATGG + Intergenic
921322604 1:213956865-213956887 ATAAATGAGAATACATAGGATGG - Intergenic
921371301 1:214425412-214425434 ATCAATGGGAACACAGAGGGCGG - Intronic
921621926 1:217334740-217334762 TTCAATGAGAAGGCAGAGATGGG + Intergenic
921766714 1:218981289-218981311 TTCAATGGGGAGACAGAGAAAGG - Intergenic
922025822 1:221747531-221747553 TTAAAAAACAAAACAGAGGATGG - Intergenic
922032504 1:221815309-221815331 TTCTATGAGAAAGGTGAGGAAGG + Intergenic
923215559 1:231845255-231845277 TACAAAGAGAAAGCAGAGAAGGG + Intronic
923278395 1:232418248-232418270 TGCAATGAGAACAGAGGGGATGG + Intronic
923331185 1:232926363-232926385 TTCAAGAAGAGAACAGAAGAGGG + Intergenic
923426030 1:233870621-233870643 TTCCATGAAAAAAAAGAGGAGGG + Intergenic
923639087 1:235734172-235734194 TTTAATGAAAAAGCAGAGTAAGG - Intronic
923884617 1:238140686-238140708 TTTAATGGGAAAACAGTGGAGGG + Intergenic
924467890 1:244314595-244314617 TACAATAAAAAAATAGAGGATGG - Intergenic
1063261886 10:4398363-4398385 TGCAATGAGAAATAAAAGGAGGG + Intergenic
1063786662 10:9392575-9392597 TTCGATGAGATAAAAGAGAAGGG + Intergenic
1064427455 10:15242861-15242883 TTCAGAGAGGAAACAGAGAATGG + Intronic
1064777375 10:18793838-18793860 TTGAAGGATAAAATAGAGGAGGG + Intergenic
1064973595 10:21090557-21090579 TTGAGAGAGAAAACAAAGGAGGG - Intronic
1065266583 10:23982858-23982880 TACAAAGAAAAAACAGAGGCCGG - Intronic
1065422892 10:25566537-25566559 TTCAATTAGAGAAAAAAGGAAGG + Intronic
1065756469 10:28935551-28935573 TTCAAAGAGAAAACACTGGCAGG - Intergenic
1065827926 10:29588818-29588840 TTACATGTGAAAACAAAGGAGGG - Intronic
1067164977 10:43858252-43858274 TTCAAAGAGAAAACAGAGCAGGG + Intergenic
1068123850 10:52813568-52813590 TGAAATGAGCAAACAGAGAAGGG + Intergenic
1068151650 10:53140031-53140053 TGCAATGAGAAAATAGTAGATGG - Intergenic
1068266635 10:54657913-54657935 TTCAATCAGAAAAATGATGAAGG + Intronic
1068756067 10:60654813-60654835 CTCTTTGAGAAAATAGAGGAAGG - Intronic
1068875158 10:61987902-61987924 TTTTATGAGAAAAGAGAGGTAGG + Intronic
1069055710 10:63842571-63842593 TTCAATGGAAGCACAGAGGAAGG - Intergenic
1071125828 10:82333769-82333791 TTCCATGAGAAAAGAGAATAAGG - Intronic
1071519724 10:86322032-86322054 TTGAACGAGAAAACAGAGAGAGG + Intronic
1072183308 10:93009574-93009596 TGCAGTGAGAACACAGAGAAAGG + Intronic
1072282187 10:93876455-93876477 TTTAAGGGGAACACAGAGGAGGG + Intergenic
1072534829 10:96354218-96354240 TGCAATGTGCAAACAGAAGACGG + Intronic
1072557238 10:96529615-96529637 TTCAATGAAAAAAAAGACCATGG + Intronic
1073020442 10:100439064-100439086 TACAGTGAGAGCACAGAGGAAGG - Intergenic
1073282567 10:102365421-102365443 TTCAATCAGAAACCAAAGAAGGG + Exonic
1073564079 10:104520597-104520619 AGCAATGAGACAACAGAGGATGG + Intergenic
1073586063 10:104711416-104711438 TTACATGAGAAAACTGAGGCTGG + Intronic
1074173743 10:110974576-110974598 ATCCATAAGAAAAGAGAGGAAGG - Intronic
1074407781 10:113193993-113194015 GTGAAAGAGAAAACAGAGGAGGG + Intergenic
1075346365 10:121684965-121684987 ATCAATGAGAAAACTGAACAAGG + Intergenic
1075358723 10:121809785-121809807 TTCAAGGGGCAAACAGAAGAAGG + Intronic
1076089728 10:127672484-127672506 TTCTATGAGAAAATACAAGAGGG + Intergenic
1076144890 10:128110234-128110256 TTCAATTAGAACAGAGAAGACGG + Intronic
1078693239 11:13602953-13602975 TTCAATGGGAAAACAAGGCAAGG - Intergenic
1078756849 11:14219210-14219232 TGCAATGAGAAGAAATAGGAAGG - Intronic
1079120435 11:17680298-17680320 TTCAAGGGGAAGAAAGAGGAAGG - Intergenic
1079360716 11:19768181-19768203 TTCCTTGAGAAAGCAGAGGCAGG + Intronic
1079614512 11:22474803-22474825 TTCTCTGAGAACACATAGGAAGG + Intergenic
1079978152 11:27118693-27118715 TTCAAATAGAAAAAAGATGATGG - Intronic
1080062775 11:27974531-27974553 AAAAATGAAAAAACAGAGGAAGG - Intergenic
1080110310 11:28559430-28559452 ATCAAAGAGAAAACAGTGAAAGG - Intergenic
1080264305 11:30385571-30385593 TGCAATAAGAAGACAGTGGAAGG - Intronic
1080460333 11:32449340-32449362 CTAGATGAGAAAACAGAGGCTGG + Intergenic
1080861650 11:36155095-36155117 ATCAATGAGAAAGCAAATGATGG - Intronic
1081157134 11:39707067-39707089 TACAATGAGAAAAATGAGAAGGG - Intergenic
1081163349 11:39779038-39779060 TTCAGTGTGAAAACATGGGAGGG - Intergenic
1083537258 11:63481113-63481135 TTCAAGGAGATACCAGAGAAAGG - Intronic
1084170327 11:67397811-67397833 CTCAATGAGAAATAAGAGGTAGG - Exonic
1084873730 11:72115472-72115494 ATACATGAGAACACAGAGGAGGG + Intronic
1085560408 11:77467275-77467297 TGCCATGTGAACACAGAGGAAGG - Intronic
1085642546 11:78201513-78201535 AGCAGTGAGAAACCAGAGGAAGG + Intronic
1085662505 11:78382163-78382185 TGCCATGAGAGCACAGAGGAGGG - Intronic
1086063783 11:82726285-82726307 GTAAATGAGAAAAGAGAGGCCGG + Intergenic
1086153732 11:83642373-83642395 TTCTATCTGAAAACAGAGAAGGG - Intronic
1086517919 11:87635353-87635375 TTAAATAAGAAAAGAGAGAAGGG + Intergenic
1087405414 11:97723280-97723302 CTCAAAGAGATACCAGAGGAAGG + Intergenic
1087593408 11:100221648-100221670 TTGAATGAGTAAATAAAGGAAGG - Intronic
1087727204 11:101734557-101734579 TTTAAGGAGAAAATAGAAGATGG - Intronic
1087964766 11:104399012-104399034 TTCAATAACAAAATTGAGGATGG - Intergenic
1088095328 11:106093433-106093455 TTTAAAGAGAAAACAGAACAGGG + Intronic
1088806866 11:113360531-113360553 TTGAATAAGAAAACTGAGAAAGG + Intronic
1088899797 11:114106773-114106795 TTCCATCAGAAAAGAGAAGATGG - Intronic
1089389256 11:118088878-118088900 TCAGATGAGAAAACAGAGGTCGG - Intronic
1089644763 11:119871544-119871566 TACATAGAGAAGACAGAGGAGGG + Intergenic
1089897997 11:121951251-121951273 GTGCCTGAGAAAACAGAGGAAGG - Intergenic
1090419445 11:126564131-126564153 TTCTCTGAGAAATCAAAGGAAGG - Intronic
1090477206 11:127034134-127034156 TGCAATGAAAATACAGAGTAGGG - Intergenic
1090703561 11:129316592-129316614 CTCAATGAGACAAGAGAGGGAGG - Intergenic
1091041686 11:132286797-132286819 TCCAATGAGAAAACAAACTAGGG + Intronic
1091082925 11:132689286-132689308 ATCAATGAGAAAACAAAGGAGGG - Intronic
1091150446 11:133323730-133323752 TTCTGGGAGAAAACAAAGGAGGG + Intronic
1091377682 12:36403-36425 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
1091530341 12:1348837-1348859 GTGAATCATAAAACAGAGGAAGG - Intronic
1091654210 12:2333473-2333495 TTCCAGGAGAAAACGCAGGAAGG - Intronic
1092696824 12:11181140-11181162 TGCAATTACAACACAGAGGAGGG + Intergenic
1093044676 12:14429175-14429197 TTCACTGAGAAAAATTAGGAGGG - Intronic
1093212055 12:16319598-16319620 TTAAATGAGAAAATGGATGAAGG + Intergenic
1093699664 12:22204674-22204696 TTCAAAGTGAAAACACAGAAAGG - Intronic
1093897662 12:24593040-24593062 TTAAAAGAGAAAAAAGAGCAAGG - Intergenic
1095167108 12:38986855-38986877 TTCAATCAGAAGACAGAGAGTGG + Intergenic
1096404841 12:51336246-51336268 TTCAATGAGAAAAGAGCAGTGGG - Intronic
1096456125 12:51788587-51788609 TTCAGTGAGAACACAGAACAGGG - Intronic
1096473574 12:51894750-51894772 TTAAATAAGAAAACAGAGGCCGG - Intergenic
1096575848 12:52552439-52552461 TCCAGAGAGAAAACAGAGGCAGG - Intronic
1096759955 12:53832959-53832981 TTCAATGGGAGAAATGAGGAAGG - Intergenic
1096912733 12:55000447-55000469 TGCAATGAGAGCTCAGAGGAGGG + Intergenic
1097062706 12:56297996-56298018 TTCAAAGAGAAAAAAAAGGGCGG - Intronic
1097862379 12:64531139-64531161 TTCTAGAAGAAAACATAGGAGGG - Intergenic
1098656780 12:73041105-73041127 TTCAATGGGAAAACAGAATGTGG + Intergenic
1098663767 12:73133493-73133515 TGAAATTAGAAAACAGAGGCTGG - Intergenic
1098879218 12:75899659-75899681 TTCAATAAAAACCCAGAGGAAGG + Intergenic
1099033138 12:77553970-77553992 TGGAAAGAGAAAACAGAGCAAGG - Intergenic
1100255808 12:92881676-92881698 TTCAGTGGAAAAACTGAGGATGG + Intronic
1100978428 12:100145496-100145518 TGCTATAAGAACACAGAGGAAGG + Intergenic
1101219442 12:102622231-102622253 TTCAAAGAGAAAAAAAAGAATGG - Intergenic
1101651022 12:106677207-106677229 TTCACTAGGAAAACAGAGAAAGG + Intronic
1101697646 12:107141338-107141360 GCCAATGAGAAAACTCAGGAGGG + Intergenic
1102624038 12:114220298-114220320 TTCAAGGAGAAAAAGTAGGAAGG - Intergenic
1103092863 12:118109886-118109908 CACATTTAGAAAACAGAGGATGG - Intronic
1103304015 12:119950045-119950067 TGCAATGAGAAAACAAGGGCTGG - Intergenic
1103974302 12:124692265-124692287 TCCCACTAGAAAACAGAGGAGGG + Intergenic
1104539942 12:129654907-129654929 TTAAATGAGAGAACAATGGAAGG - Intronic
1104604457 12:130177652-130177674 TTTTATGAGAAAACAAAAGATGG - Intergenic
1104836173 12:131793064-131793086 TTCAGTGAGGAAAAAGAGAAAGG + Intronic
1105250396 13:18693954-18693976 TTCAATCAGAAAACACAGCATGG - Intergenic
1105497731 13:20945426-20945448 TTTAATGAAGGAACAGAGGAAGG + Intergenic
1107182380 13:37475806-37475828 TTAGATGAGAAAACAAAGGTGGG - Intergenic
1107612621 13:42131494-42131516 TTCAATGAGAAAACAGTATTTGG - Intronic
1107614387 13:42149303-42149325 TGCAATGAGAACACAGTGAAGGG - Intronic
1108483509 13:50900762-50900784 GTCTGTGAGAAAAAAGAGGAGGG - Intergenic
1108807460 13:54176437-54176459 CTCAATGAGAATGCAGTGGAAGG - Intergenic
1109082065 13:57916667-57916689 CACAATAAGAAAACAGAGTAAGG - Intergenic
1109272655 13:60271792-60271814 TTCAGTGAGAGAATAGAGGAAGG + Intergenic
1109677198 13:65693220-65693242 TTAAATGAGAAAATAGATAAGGG - Intergenic
1109818515 13:67620173-67620195 TCCTATGATAAAACAGAGCAGGG + Intergenic
1110013253 13:70365722-70365744 TTCAATGAGAAAACAGTAGCAGG - Intergenic
1110018399 13:70438086-70438108 TTTAAAAAGAAAATAGAGGATGG + Intergenic
1110432407 13:75440367-75440389 AGCAAAGAGAAAACAGAGGAGGG + Intronic
1110760461 13:79225136-79225158 TTCAATGAGTAGACCTAGGAGGG - Intergenic
1110817751 13:79880408-79880430 TTGGATGAAAAAACTGAGGATGG + Intergenic
1110907245 13:80907123-80907145 TTCCATGGCAAAAAAGAGGAAGG + Intergenic
1111708518 13:91782249-91782271 TTGAATGAGAAAACACAGCTTGG - Intronic
1111906647 13:94263063-94263085 TTAAATGAGACAACATATGAAGG - Intronic
1112234448 13:97622928-97622950 TTAAATGAGATAGCAGTGGAGGG + Intergenic
1112848300 13:103671675-103671697 TTTCATGAGAAATCAGAGGCCGG - Intergenic
1113281523 13:108793608-108793630 GTCAATGAGAAAAACGATGAAGG + Exonic
1114554384 14:23553297-23553319 CTCAATGAAAAAGCAGAGGCTGG + Intronic
1115619892 14:35131241-35131263 TTCAATCAGAAAGAAAAGGATGG - Intronic
1115655451 14:35439290-35439312 TTGAATGAGGAAAGGGAGGAGGG - Intergenic
1115750387 14:36483454-36483476 TTCAGTGATAATAGAGAGGATGG - Intronic
1115848772 14:37570054-37570076 TTGAATGAGACAATAGAGGGGGG + Intergenic
1115925583 14:38429704-38429726 GAGAATGAGAAAACAGAAGATGG + Intergenic
1115995685 14:39193557-39193579 TTCAAGGAGAAAAGAGAGAATGG - Intergenic
1116276779 14:42844529-42844551 TTCACTAAGAAAAGACAGGAAGG - Intergenic
1116607416 14:47018917-47018939 TGCCATGTGAACACAGAGGACGG - Intronic
1116970443 14:51059175-51059197 ACCGATCAGAAAACAGAGGAAGG + Intronic
1117193314 14:53315669-53315691 TTCAAGGAGATACCAGAGAAAGG - Intergenic
1117339005 14:54777974-54777996 TTCTGCGTGAAAACAGAGGATGG - Intronic
1117611456 14:57487149-57487171 TTCAAAGAGAACACAATGGAAGG + Intronic
1117720652 14:58625735-58625757 GGCAATGAGAATAGAGAGGAAGG + Intergenic
1119754536 14:77105861-77105883 TTCACTCACAAAACAGAGGAAGG - Intronic
1120481128 14:85050778-85050800 TGGAATGAGTCAACAGAGGATGG - Intergenic
1121854937 14:97259505-97259527 TGCAATGTGAAATCAGAAGAGGG - Intergenic
1127591961 15:60433822-60433844 TTCAATGAGAAAAGCGAGGCAGG + Intronic
1128075583 15:64823539-64823561 TTAAAAGAGAAAGCAGAGGCCGG - Intronic
1128400392 15:67273770-67273792 TGCAAAGAGAAAACATTGGAAGG - Intronic
1130902724 15:88219217-88219239 ATCAATGAAAAAAGACAGGAGGG + Intronic
1131355622 15:91743238-91743260 TGCACTGAAGAAACAGAGGAGGG - Intergenic
1132097353 15:98997748-98997770 ATGAATGAGAAAACTGAGGCTGG + Intronic
1132435572 15:101798890-101798912 TTTAATGAGAATACATATGAAGG - Intergenic
1132449245 15:101956589-101956611 TTCTATGAGAAAGAAGGGGAGGG - Intergenic
1133553241 16:6879770-6879792 TCCAATGTCAAATCAGAGGAAGG - Intronic
1133851036 16:9503860-9503882 TTCACTGAAAATGCAGAGGAAGG - Intergenic
1133893284 16:9902032-9902054 TACAGAGAGAAAACAGAGGTGGG + Intronic
1137703398 16:50515863-50515885 TTCAATCAAAAAACATAGAATGG - Intergenic
1139318734 16:66095755-66095777 TAAAAGGAGCAAACAGAGGAGGG - Intergenic
1140188545 16:72795405-72795427 TTCAATTCAAAAACAGAGGCAGG - Exonic
1140379901 16:74477400-74477422 TGCAGTGAGAAAACAGAGACTGG - Exonic
1140382712 16:74504926-74504948 TTAAATTATAAAACAGAGAAGGG + Intronic
1140546855 16:75818394-75818416 TTTAATAAGAAAACTGAGAAGGG - Intergenic
1140588619 16:76324473-76324495 TGCCAGGAGAAAACAGAGCATGG + Intronic
1140607633 16:76560300-76560322 TGCTATGAGAAAAGAGAGGCAGG - Intronic
1140619923 16:76717271-76717293 ATCAAGGAGAAACCAGAGAAAGG + Intergenic
1141683640 16:85557727-85557749 TTCACTGAGTTAACAGAGCAGGG + Intergenic
1141768418 16:86073856-86073878 TTCAATGTGATAACAGACAAGGG + Intergenic
1141802079 16:86316785-86316807 TTCCACGAGAGAACAGAGAAGGG + Intergenic
1142869121 17:2809162-2809184 TCCAATGAGAAACCAGAACAGGG - Intronic
1142933329 17:3307137-3307159 TGCTATGGGAAGACAGAGGAAGG + Intergenic
1144276470 17:13673273-13673295 CTCAAGGAGATATCAGAGGAAGG + Intergenic
1144377091 17:14654907-14654929 TTCAATAAGAAAACATAGAGTGG - Intergenic
1145215964 17:21052647-21052669 TTCAAAGAGAAAGAAGGGGATGG + Intergenic
1146222067 17:31032806-31032828 TTCTGTGTGAAAACAGAAGAGGG - Intergenic
1147029852 17:37623971-37623993 TTCTATAAGAAACCAGAGGAGGG + Intronic
1147869575 17:43578026-43578048 TTCAGAGAGAGAACAGAGGCTGG + Intronic
1148990758 17:51665102-51665124 ATCTATTAGATAACAGAGGAGGG + Intronic
1149186736 17:54007026-54007048 TTCAATAGGAAAACAGAGTTTGG - Intergenic
1149219609 17:54401366-54401388 TTCCACAAGAAAATAGAGGAAGG + Intergenic
1149504999 17:57186875-57186897 TTGAATGAGAGAATAAAGGAAGG + Intergenic
1149792543 17:59492045-59492067 GTGAAAGAGAAAACAGACGAAGG + Intergenic
1149982723 17:61324049-61324071 CACACTGAGAACACAGAGGAAGG - Intronic
1150202288 17:63369998-63370020 TTAAATGAGAAGAGAGAGCAGGG - Intronic
1150228269 17:63535428-63535450 TCCAGTGGGAGAACAGAGGAAGG - Intronic
1150619903 17:66800239-66800261 TACAGTGAGAAAGAAGAGGAAGG + Intronic
1150747523 17:67827347-67827369 TTCTGTGAGAAAACAGAAGAGGG - Intronic
1150792129 17:68207250-68207272 TTCTGTGTGAAAACAGAAGAGGG - Intergenic
1151138532 17:71970436-71970458 TTCACTGAGAAAACAGAAGCAGG - Intergenic
1153016068 18:583741-583763 TTAAATGAGAAGACATAGAAAGG + Intergenic
1153116928 18:1669379-1669401 TGCAATGGGAACACAGAAGAGGG + Intergenic
1153487499 18:5614695-5614717 TTCACTGAGAAACCAGAGGCAGG + Intronic
1153886006 18:9467297-9467319 TTCAATTAAAAAACAGACAAAGG - Intergenic
1154187638 18:12200044-12200066 TTAAATGAAAACACAGAGCAGGG - Intergenic
1154428376 18:14289636-14289658 TTCCAGGGGAAAACTGAGGAAGG + Intergenic
1154438450 18:14364972-14364994 TTCAATCAGAAAACACAGCATGG + Intergenic
1155014720 18:21821895-21821917 ATAAATAAGAACACAGAGGAAGG - Intronic
1156134193 18:34016696-34016718 TGAAATGAAAGAACAGAGGAAGG - Intronic
1156195142 18:34766474-34766496 AACAATGAGAACACACAGGAAGG + Intronic
1157108649 18:44798981-44799003 TTCACTGAGGAACCAAAGGATGG - Intronic
1157274422 18:46300837-46300859 TTAAATGAGACAACAGATGCAGG - Intergenic
1158296687 18:56004261-56004283 TTAAATGAAAAAATAGAGAAAGG - Intergenic
1158496384 18:57958792-57958814 TTCAGTGAGAAATAAAAGGATGG - Intergenic
1158939620 18:62395043-62395065 TACAATAAAAAGACAGAGGAAGG + Intergenic
1159066818 18:63578536-63578558 TTCACCAAGAAAACAGAGTATGG - Intergenic
1159086862 18:63802394-63802416 TTTAATGAGAGAATAGAGAAGGG - Intronic
1159573001 18:70141900-70141922 TGCACTCAGTAAACAGAGGAAGG + Intronic
1159751974 18:72314017-72314039 TTTGAAGAGACAACAGAGGAAGG + Intergenic
1160526298 18:79540380-79540402 TCCAAGGAGGAAACAGAGGCTGG - Intergenic
1160636011 19:75964-75986 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
1160955014 19:1687151-1687173 TCCAATGAGAAAACCACGGAGGG + Intergenic
1161342290 19:3749965-3749987 CTAAATGAGAAAACTGAGGCTGG - Intronic
1163571769 19:18086504-18086526 TTCAATGAGAAAAAAAACTAAGG - Intronic
1164986698 19:32653625-32653647 TCCAATCAGATAGCAGAGGAGGG + Intronic
1165064637 19:33221792-33221814 GTCAAAGAGAGAGCAGAGGAAGG + Intronic
1166439545 19:42800105-42800127 TTCAATAAGAAAAAACTGGATGG + Intronic
1166457583 19:42955646-42955668 TTCAATAAGAAAAAACTGGATGG + Intronic
1166474527 19:43110872-43110894 TTCAATAAGAAAAAACTGGATGG + Intronic
1167683420 19:50940367-50940389 TGTAATGAGAAAACAGAGGTGGG + Intergenic
1167829656 19:52008880-52008902 TTCAGTGAGAAAAAAAAGGTTGG + Intergenic
1168106666 19:54169559-54169581 TCCAAGGAGAAAACAAAGGAAGG - Exonic
925119414 2:1405632-1405654 ATCTGTGAGAAAACAGAAGAGGG - Intronic
925230915 2:2233246-2233268 TCCAAAGAGAAAACAGAGCAAGG + Intronic
925253122 2:2458710-2458732 TTCAAGGCCAAAACACAGGATGG + Intergenic
925712205 2:6752439-6752461 TAAAATCAGAAAACAGAGAAGGG + Intergenic
926367805 2:12149303-12149325 TTCAACCAAGAAACAGAGGAAGG - Intergenic
926561099 2:14418428-14418450 TTCACTAGGAAAACAGAGAAGGG + Intergenic
926702642 2:15813928-15813950 TTCCTTGAGACAAGAGAGGAAGG - Intergenic
926905290 2:17799789-17799811 ATCAATGAGAAAACAGGCCAAGG + Intronic
927004842 2:18837216-18837238 GTCTATGAGAACAGAGAGGAAGG - Intergenic
927048370 2:19302876-19302898 CTCAGTGAAAAAACAGAAGAGGG + Intergenic
927300900 2:21513075-21513097 TTCAAAAAGAAAAATGAGGAGGG - Intergenic
927365265 2:22287558-22287580 TTCAAAGAGATAAAAGAGAAAGG + Intergenic
928068773 2:28193782-28193804 TAAAATGAGAAAGCAAAGGAGGG - Intronic
928236502 2:29546483-29546505 TTCAATGAGAAACAGGAGGAAGG + Intronic
928322349 2:30293832-30293854 TTAAAGGAAAAAAAAGAGGAAGG + Intronic
928342036 2:30452283-30452305 TTAAATGAGAAAAAACAGCAGGG + Intronic
928405192 2:31009408-31009430 AACAATGAGAAATCAGGGGAAGG - Intronic
928408694 2:31036087-31036109 TTCAATCAAAAAACAGAGCGTGG - Intronic
929329599 2:40665320-40665342 TTAAATGAGAAAACATATGAGGG + Intergenic
930349765 2:50235796-50235818 CTCAAGGATAAAAAAGAGGATGG + Intronic
930896659 2:56453964-56453986 TTTAATGAGGAAACAGAGATGGG - Intergenic
931003515 2:57819599-57819621 TTGACTGAGAAGATAGAGGAAGG + Intergenic
932335330 2:70927886-70927908 GACCCTGAGAAAACAGAGGAGGG + Intronic
932554530 2:72809132-72809154 TTCAAGTATAACACAGAGGAAGG + Intronic
933209354 2:79549157-79549179 TTAAATGATATAACGGAGGAAGG - Intronic
933319901 2:80760115-80760137 TTCAATGGGAAAAGCAAGGATGG + Intergenic
933783564 2:85819460-85819482 ACCAATGAGAAAACTGAGGCAGG - Intergenic
934482165 2:94661147-94661169 TTCATTGAGAAAGAAAAGGATGG + Intergenic
934600920 2:95657724-95657746 TTCAGAGAGAAGACAGAAGATGG - Intergenic
935125458 2:100218609-100218631 ATGAATGGGAAAAGAGAGGAAGG - Intergenic
936267889 2:111024106-111024128 CCCAATGAGAAGACAGAGGTAGG + Intronic
936565469 2:113579086-113579108 TTCTATGAGAAAGAAGGGGAGGG - Intergenic
937747684 2:125434414-125434436 ATCAATAAGAAATCAGAGGCTGG + Intergenic
937868299 2:126770145-126770167 TTGAAAGAGAAGGCAGAGGAGGG - Intergenic
939104476 2:137933183-137933205 TTCAATCAGAGAACACAGCATGG - Intergenic
939129680 2:138219787-138219809 TTGAATGAGATAAAAGATGAAGG - Intergenic
939496946 2:142936085-142936107 TTGAATGAGGAAAAAGAGGTAGG + Intronic
939833049 2:147095610-147095632 TTCTATGAGAAATCAGATTAGGG - Intergenic
939919257 2:148087916-148087938 TTCAAAGAGATACCAGAGAAAGG + Intronic
940015709 2:149101820-149101842 CTCAATGAGATATCAGAGGCAGG + Intronic
940154754 2:150643714-150643736 TTTGATGACAAGACAGAGGAAGG - Intergenic
940614666 2:156035392-156035414 TTCAAAAATAAGACAGAGGAAGG - Intergenic
941171094 2:162138379-162138401 TTCAAACAGAAACCAGAGCAAGG - Intergenic
941624037 2:167810425-167810447 TTCAATGAAAAAACAAACAAAGG - Intergenic
941628846 2:167861955-167861977 TTCCTTGAGACACCAGAGGATGG + Intergenic
942211746 2:173678176-173678198 ATCAATGTGAACACAGAGGGAGG + Intergenic
943425593 2:187729117-187729139 TTCAATGAGATACTAGGGGAGGG + Intergenic
943607735 2:189996534-189996556 TTCAAGGAGATACCAGAGAAAGG - Intronic
943829318 2:192438803-192438825 GTTAATGAGAAAACTGAGGTGGG - Intergenic
944911745 2:204317406-204317428 TGCTATGGGAACACAGAGGAGGG + Intergenic
944947095 2:204701197-204701219 TTCAAGGAAAAAGCAAAGGAAGG - Intronic
945048406 2:205801448-205801470 GTCACTGAGAAAACTCAGGAAGG - Intergenic
945261163 2:207844637-207844659 TTTGATGAGAAAACAAGGGAAGG - Intronic
945399708 2:209366103-209366125 TCCAAAGATAAAAAAGAGGACGG - Intergenic
945732670 2:213559401-213559423 TTTAAGGAGAAACAAGAGGAAGG + Intronic
945805660 2:214487081-214487103 TTCCATGTGAAGACAGAGGAAGG + Intronic
945972541 2:216244715-216244737 TGAAATAAGAAACCAGAGGAAGG + Intergenic
946140726 2:217688392-217688414 TTAAATGGGGGAACAGAGGATGG + Intronic
946667774 2:222068699-222068721 TTAAATGAGATAATAGAGGTAGG - Intergenic
946669599 2:222088683-222088705 TGCAATGAGAAGCCAGTGGAAGG + Intergenic
948566698 2:238891809-238891831 CTCTAGGAGCAAACAGAGGAAGG - Intronic
1169933466 20:10858290-10858312 CTCCATCAGAAAGCAGAGGAGGG - Intergenic
1170134174 20:13054857-13054879 TTCATGGAGAAAAAAGAGAAAGG + Intronic
1170134821 20:13061355-13061377 TTCATTGAGAAAATAGAAAAAGG + Intronic
1170329655 20:15194507-15194529 TTCACTGAGAAATCAGTGAAGGG - Intronic
1172215117 20:33230286-33230308 TTCAAAGAGCAAACACAGGAGGG + Intergenic
1172264126 20:33595885-33595907 TTCATTTGTAAAACAGAGGAAGG - Intronic
1172437990 20:34943665-34943687 TTCTATGAGAACACATAGTAGGG - Intronic
1172703893 20:36868966-36868988 TTCATTGAGAAAACAGAAGTGGG - Intergenic
1174250050 20:49212513-49212535 CTCAATGAAAAAACAGAGAAAGG - Intergenic
1174265899 20:49331917-49331939 GTCAAGGAGAAAACAGAGTTAGG - Intergenic
1174404648 20:50295503-50295525 TGCAATAAGCAAACAGAAGAGGG + Intergenic
1174727921 20:52883534-52883556 CACAATTAGAAAATAGAGGAGGG - Intergenic
1175324937 20:58117417-58117439 TGCAAGGAGAAAAAAGAGAATGG + Intergenic
1175717187 20:61262905-61262927 TTCAAAGAAAAAAGAAAGGAAGG - Intronic
1176457226 21:6924500-6924522 TTCAATCAGAAAACACAGCATGG - Intergenic
1176835399 21:13789584-13789606 TTCAATCAGAAAACACAGCATGG - Intergenic
1177153666 21:17480164-17480186 TTGAAACAGCAAACAGAGGATGG - Intergenic
1177658449 21:24050427-24050449 TTTACAGAGAAAAAAGAGGAAGG + Intergenic
1177769105 21:25495057-25495079 GCCAGTGAGAAAACTGAGGAAGG - Intergenic
1177864153 21:26492883-26492905 TTCTATGAGATCAGAGAGGACGG + Intronic
1178083510 21:29090265-29090287 TTCAATGAAAGAAGTGAGGAAGG + Intronic
1179155767 21:38849773-38849795 TTCACTGTGAAGACAGAGGAAGG + Intergenic
1179238709 21:39569471-39569493 TTGAATGAGAAAGCAGAGTGAGG - Intronic
1179356490 21:40665177-40665199 TTCAAAGAAAACACAGAGGCAGG + Intronic
1179525752 21:41974841-41974863 TTCGATGAGAGAGGAGAGGAGGG + Intergenic
1180055217 21:45355203-45355225 CTCATTCAGAAAACAGAAGAAGG + Intergenic
1180202653 21:46234792-46234814 AGCAAGGAAAAAACAGAGGATGG - Intergenic
1180818739 22:18810190-18810212 TTCACTAAGAAATGAGAGGAAGG + Intergenic
1180820593 22:18824593-18824615 TTCATTGAGAAGGCAGAAGATGG + Intergenic
1181204963 22:21244645-21244667 TTCACTAAGAAATGAGAGGAAGG + Intergenic
1181206816 22:21259065-21259087 TTCATTGAGAAGGCAGAAGATGG + Intergenic
1181399948 22:22645252-22645274 GTCAAGGAGGAGACAGAGGATGG - Intronic
1181524390 22:23471636-23471658 TTAAATGAAAACACAGAGCAGGG + Intergenic
1181649417 22:24250537-24250559 GTCAAGGAGGAGACAGAGGATGG + Intergenic
1181701922 22:24626352-24626374 GTCAAGGAGGAGACAGAGGATGG - Intronic
1181898191 22:26129675-26129697 TTCAATGGGAAATCATTGGAAGG - Intergenic
1182906468 22:33941777-33941799 TTCAATAAGGAAGCTGAGGAAGG + Intergenic
1182923122 22:34098329-34098351 TTCATTCATAACACAGAGGAGGG - Intergenic
1183178566 22:36243112-36243134 TTCAAGGAGATAGCAGAGGAAGG - Intergenic
1184970443 22:48016262-48016284 TGTAATGAAAACACAGAGGAAGG - Intergenic
1184995638 22:48205554-48205576 TTCAGTGAGTAATCAGGGGAAGG + Intergenic
1203220107 22_KI270731v1_random:36358-36380 TTCATTGAGAAGGCAGAAGATGG - Intergenic
1203221962 22_KI270731v1_random:50770-50792 TTCACTAAGAAATGAGAGGAAGG - Intergenic
1203268867 22_KI270734v1_random:36043-36065 TTCACTAAGAAATGAGAGGAAGG + Intergenic
1203270719 22_KI270734v1_random:50468-50490 TTCATTGAGAAGGCAGAAGATGG + Intergenic
949375663 3:3386937-3386959 TTCAGTGAAAATACAGAGTATGG - Intergenic
949819342 3:8099296-8099318 TTCAATGAGATCATAGAGAAGGG - Intergenic
950121534 3:10485233-10485255 TTCAATGAGAAAACCACAGAAGG - Intronic
951188463 3:19741542-19741564 TAGCATGGGAAAACAGAGGAGGG - Intergenic
951859013 3:27229572-27229594 CTCAAGGAGATAACAGAGGAAGG + Intronic
951946055 3:28137569-28137591 TACCATGAGAAAACTGAGGAAGG + Intergenic
952653485 3:35755327-35755349 TACAATGAGAAAACAGACTTAGG - Intronic
953382328 3:42481322-42481344 CTCAAGGAGATAACAGAGAAAGG + Intergenic
953458745 3:43064421-43064443 GGCAATGTGAAAACAGAGGTAGG - Intergenic
954991291 3:54842913-54842935 TTCTAGGACAAATCAGAGGAAGG + Intronic
955883543 3:63573581-63573603 TCCACTGATAAAACAGAGGGAGG - Intronic
956330127 3:68097582-68097604 TTCAATAAGATATGAGAGGAAGG + Intronic
957116626 3:76035097-76035119 TTCAAAGATAAAACATATGAAGG - Intronic
957219032 3:77358299-77358321 AAGAATGAGAGAACAGAGGAAGG - Intronic
957611609 3:82473791-82473813 TTCAGTTAGAAAATAGAAGAAGG - Intergenic
957959208 3:87227535-87227557 TTCAAGAAGAAAACCGTGGATGG + Exonic
958977078 3:100680743-100680765 TACTATGAGAGAACGGAGGATGG - Intronic
959130691 3:102352800-102352822 TTCATTGAGAAAACAGATGTTGG + Intronic
959248842 3:103912825-103912847 TTTCATAAGAAAAAAGAGGATGG + Intergenic
960392012 3:117088997-117089019 TTGAATGATGAAACAGAGGCAGG - Intronic
961059923 3:123820078-123820100 TTCACTGAGAGCACAGAGCAGGG + Intronic
961910117 3:130305864-130305886 CTGACTGTGAAAACAGAGGAGGG - Intergenic
962483575 3:135819041-135819063 TTCAATGAAAAGACATAGAATGG + Intergenic
962947911 3:140188624-140188646 TTCAAAGAGGAGACAGAGCAAGG + Intronic
963381106 3:144531211-144531233 TTAAATGAGAAAAAAGAAAAAGG - Intergenic
963467580 3:145702287-145702309 TTGAATAAGAAAACAGGTGAAGG + Intergenic
963919858 3:150894960-150894982 TACTATGAGAAAACAGAGGGAGG + Intronic
964973111 3:162585521-162585543 ATCAAGCAGAAAGCAGAGGATGG + Intergenic
965280385 3:166744210-166744232 TTCACAGAAAAAATAGAGGAAGG + Intergenic
965495581 3:169394642-169394664 CATAATGAGAAAACAGAGGGTGG + Intronic
966248402 3:177834474-177834496 TCCAAGGAGAACAAAGAGGAGGG + Intergenic
966367463 3:179205383-179205405 ATCAAAGAGAGAACAGAGTATGG + Intronic
966884929 3:184372146-184372168 TTGAGTCAGAAAACAGAGAAAGG - Exonic
967099822 3:186207128-186207150 TTCTATGAGACCACAAAGGAAGG - Intronic
967286957 3:187881231-187881253 TACAATGGGAACACAGAGAAAGG + Intergenic
967358288 3:188598727-188598749 TTAAAGGAAAAATCAGAGGATGG - Intronic
967958577 3:194900116-194900138 TTCAAGGAGGAACCAGAGAAAGG - Intergenic
968884450 4:3320115-3320137 TTCAAGGAGAAAGCAGGTGAAGG - Intronic
969172188 4:5373121-5373143 CTCAAACAGAAAACAGAGTAAGG + Intronic
969513715 4:7634563-7634585 TTGAATGAGTAAACAATGGAGGG + Intronic
970043469 4:11822901-11822923 TTAAATGAGAAAAAAAGGGAAGG + Intergenic
970074581 4:12203078-12203100 TGCCATGGGAACACAGAGGAAGG + Intergenic
970319260 4:14859827-14859849 ATCAATGAGAAAATAGGGGTTGG + Intergenic
970421005 4:15905784-15905806 TTCGATGTGAAGACAGTGGAAGG - Intergenic
970427614 4:15959926-15959948 TTCCATGTGAAGACAGAGGCAGG + Intergenic
971472147 4:27039222-27039244 TTCAAAGAGGAATCAGAGAAAGG - Intergenic
972426377 4:38937069-38937091 TTTAAAGAGAAAAAACAGGAAGG - Intronic
972708765 4:41572628-41572650 TTGGATGAGAAAACACAGAAAGG + Intronic
973801706 4:54484770-54484792 CTCAGTGAGAAAAGAAAGGAAGG + Intergenic
974958556 4:68672926-68672948 TCCAATGAGGAAAAAGAGGTAGG - Intergenic
975032625 4:69640268-69640290 TTCTTTGAGAAAACTGAGAATGG - Intronic
975059626 4:69981124-69981146 ATAAATGAGAAAGCAGAGAAAGG - Intergenic
975850431 4:78566280-78566302 TGGAATGTGAGAACAGAGGAGGG - Intronic
975944904 4:79694931-79694953 CTCAAGGAGATAACAGAGGAAGG - Intergenic
976763596 4:88576308-88576330 TTCAATGAGAAGCCACTGGAAGG - Intronic
977534583 4:98242170-98242192 TTTAATGGGAAAACAGAGGAAGG - Intergenic
977554109 4:98471311-98471333 TTCAAAGAGAAAGAAGGGGAGGG + Exonic
977703047 4:100042304-100042326 TTCCTTGAGAAAACTGAGGTGGG - Intergenic
978045953 4:104127811-104127833 TTATATGAAAAAAAAGAGGAAGG + Intergenic
978411104 4:108426809-108426831 ATCAATGAGAGAACAGAGTCTGG - Intergenic
978520072 4:109606306-109606328 TTCAATCAGAAGACAGAGAGTGG - Intronic
978855574 4:113390520-113390542 TGCAATGATAAAAAAGAGAATGG + Intergenic
979704186 4:123701549-123701571 TGCAATGAGAAAATAAAGTATGG - Intergenic
979950281 4:126884257-126884279 TATAATGAGAGAAGAGAGGAGGG + Intergenic
980270720 4:130580751-130580773 TCCATTTAGAAAAAAGAGGAGGG + Intergenic
980339772 4:131530546-131530568 TTCAATCAAAAAACATAGGATGG + Intergenic
980614349 4:135199172-135199194 TTCACAGAGAGAACGGAGGAAGG - Intergenic
981018249 4:139998092-139998114 TAGAATGAGAAGACAGAGAAAGG - Intronic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981343705 4:143651358-143651380 TTCAATAGGAACTCAGAGGATGG + Intronic
981859225 4:149334729-149334751 TTCAATGATAAAACAGTGTGTGG + Intergenic
982028005 4:151271298-151271320 TTGAATTAGAAAACAGACAATGG + Intronic
982147818 4:152417083-152417105 TTCAACGAAACAACAAAGGAGGG - Intronic
982578886 4:157153333-157153355 TTGAATGAGAAACAATAGGAAGG - Intronic
982662284 4:158221639-158221661 TTAAATGAGAAGACAAAAGAAGG - Intronic
983353214 4:166621213-166621235 CTTCATGAGAAAACAGGGGATGG + Intergenic
983486189 4:168333378-168333400 TTCAATAATAAAACATCGGAGGG + Intergenic
983546907 4:168974843-168974865 CTCAAGGAGATACCAGAGGAAGG - Intronic
983807711 4:172016508-172016530 TTCAAGGAGATACCAGAGAAAGG - Intronic
984329932 4:178301451-178301473 TTCTAGGAGAAGACAGAGGGTGG + Intergenic
985359809 4:189161460-189161482 TTAAATCAGAAAAGAGAGAAGGG - Intergenic
985618907 5:942595-942617 TTCTAGAAGAAAACAGAGGAAGG - Intergenic
985865661 5:2512140-2512162 TTTAATAAGAAAATAGTGGAAGG - Intergenic
985899807 5:2779785-2779807 GGCAAAGAGAAAACAGACGAGGG - Intergenic
986247335 5:6021999-6022021 TTCAATTAGAAAACATATAAAGG - Intergenic
986803013 5:11280897-11280919 ATCAAGGAGCAAACAGAGTAAGG + Intronic
989198460 5:38738769-38738791 TTCAATGGGAAAATTGAAGATGG + Intergenic
989430563 5:41350217-41350239 TTCAATGAGAAAACAGAGGACGG - Intronic
989478653 5:41903385-41903407 TTCCATGAGAAACAATAGGATGG + Intergenic
989609000 5:43273559-43273581 GGCAATGAGAAAACATAGCAAGG - Intronic
989620892 5:43383340-43383362 TTCAGGGAAAAAACAGAGGTGGG + Intronic
990167130 5:53006757-53006779 GGCACTGTGAAAACAGAGGAAGG - Intronic
990793562 5:59513431-59513453 TTTAATGAGAAAACATTGTAAGG + Intronic
990842026 5:60092574-60092596 TTCAATAAAAAAAGAGAGAATGG + Intronic
991467262 5:66927017-66927039 TTAAATTAAAAAACATAGGAAGG - Intronic
992051726 5:72947229-72947251 TTCAATGAGATAATACATGAAGG + Intergenic
992525617 5:77607260-77607282 TAAAATGAGGAAATAGAGGAAGG + Intronic
992542656 5:77779911-77779933 TTGAATTACAAAAGAGAGGAGGG - Intronic
992828569 5:80572060-80572082 TCCAATGAGAAATCTGAAGAGGG - Intergenic
992864078 5:80940312-80940334 TGCAAGGGGACAACAGAGGAAGG - Intergenic
992994848 5:82322800-82322822 ATCAGTGAGAAAACAGGTGAGGG + Intronic
993616346 5:90117114-90117136 TTCAATTAGAAAAGAGCAGATGG - Intergenic
993687160 5:90952223-90952245 GTCAGAGAGAAAACAGAGGGAGG - Intronic
994240788 5:97418450-97418472 TTCAATCAGGACACAGATGAGGG + Intergenic
994488957 5:100417141-100417163 TTTAATGAGAAAACAAGAGAAGG - Intergenic
994580905 5:101640721-101640743 TTGAATAAGAAACCAGAAGAGGG - Intergenic
995155481 5:108907249-108907271 TTTAATGAGAAGGCAGAGGAGGG - Intronic
995178515 5:109207486-109207508 TACAATGAAAAGACAGATGATGG + Intergenic
995637405 5:114209315-114209337 TTTAAGGAGCAAGCAGAGGAAGG - Intergenic
996136784 5:119852587-119852609 TTCAATGATGAGACAGAGGAAGG - Intergenic
996664458 5:126042720-126042742 TTTAATGTGAAAACAGATGCTGG + Intergenic
997313418 5:132910488-132910510 TCCAATGAGAGGACAGAGAAGGG - Intronic
997610957 5:135215397-135215419 CTCCCTGAGGAAACAGAGGAAGG - Intronic
997974417 5:138431580-138431602 TGCAATGAGAAGACAGAGTGGGG - Intronic
998316987 5:141191796-141191818 TTTTATGAGAGAATAGAGGAGGG + Intronic
999158966 5:149479497-149479519 TTCAAAAAGAAAAAAGAGCAAGG + Intergenic
999300967 5:150490141-150490163 AGCTATGAGAAAACAGAGGGTGG - Intronic
999608737 5:153346061-153346083 TCCAATGAGAAGACAGAACAGGG - Intergenic
1001603294 5:172943154-172943176 TTGAATGAGAAAAGAGGAGAAGG + Intronic
1002234185 5:177792333-177792355 TTCATTTGGAAAACAGAAGATGG + Intronic
1003264815 6:4556205-4556227 TTCCAAGAAAAAAAAGAGGAAGG + Intergenic
1003491619 6:6627241-6627263 TTGAATGAGAAAATAGATAAAGG - Intronic
1004151908 6:13128351-13128373 CTCAAGGAGATAACAGAGAACGG + Intronic
1004606835 6:17202767-17202789 TTCAAAGAGAACACAGGGAAAGG + Intergenic
1004608631 6:17217534-17217556 TTCAATAACAGAAGAGAGGAAGG + Intergenic
1004704343 6:18109869-18109891 TTCTATCAGAAAATAAAGGAGGG + Intergenic
1004966899 6:20862397-20862419 TACAATGGGAAAACTGAGGTTGG - Intronic
1005713658 6:28526222-28526244 TTCAAGGAGAAAAAAAAGCAAGG - Intronic
1006428253 6:33979445-33979467 TTGAATGAGAAAATAGAGAAAGG - Intergenic
1006570626 6:35000486-35000508 TTCAAAGAAAAAAAAGTGGAGGG + Intronic
1007054755 6:38871634-38871656 TTTAATGAGAAAACTGCAGACGG + Intronic
1007692565 6:43712192-43712214 TTCAATGAGATAGTAGAGGCTGG + Intergenic
1008608350 6:53162747-53162769 TTTCATGAGGAAACAGAGGGTGG - Intergenic
1009198513 6:60716100-60716122 TTCAAGGAAAAAACGGAAGAAGG - Intergenic
1009314863 6:62205435-62205457 TTCAATGACAACACAAAGTACGG + Intronic
1009345726 6:62611408-62611430 TGCAAAGAGAGAACAGAGAAGGG + Intergenic
1009802054 6:68551085-68551107 TTCAATCAAAAAACATAGAAGGG + Intergenic
1011312514 6:85995762-85995784 TTCAATCAGAAATCTGAGGTAGG + Intergenic
1011775578 6:90727021-90727043 GTCAATGAGATAGCTGAGGAGGG + Intergenic
1012203317 6:96433526-96433548 CTCAAGGAGATAACAGAGAAAGG - Intergenic
1012388659 6:98710879-98710901 TTCAATGTGAAAAACGCGGATGG - Intergenic
1012832749 6:104226287-104226309 TTTAAAAAGAAAACAGAGAAGGG + Intergenic
1014151976 6:118067739-118067761 GACAATGAGAAAGCAGAGGCAGG + Intronic
1014455370 6:121627492-121627514 TTGAAAGAGATCACAGAGGAAGG - Intergenic
1015204477 6:130619082-130619104 TTCACTGAGACTCCAGAGGAAGG + Intergenic
1015286113 6:131488395-131488417 CCAAATGAGAAAACAAAGGAGGG + Intergenic
1015793919 6:136991745-136991767 TTTAAAGAGAAGGCAGAGGAAGG - Intergenic
1017127304 6:151078203-151078225 TCAAATGAGCAAGCAGAGGAAGG + Intronic
1017194984 6:151690406-151690428 CTCATTGAAAAAATAGAGGAGGG - Intronic
1017295160 6:152785292-152785314 TTCAAGGAGAAAGCAGAATAAGG - Intergenic
1017872016 6:158494371-158494393 TTGAATGAGAAAACAAATGATGG + Intronic
1018398058 6:163395991-163396013 TTCACTGAGAACAGAAAGGAAGG + Intergenic
1018430834 6:163721147-163721169 TTCAGAGAGAAAGCATAGGATGG - Intergenic
1018460233 6:163991419-163991441 TTCAATCAAAAAAAGGAGGAAGG + Intergenic
1018920950 6:168173422-168173444 TTTAATGACAAAAATGAGGAAGG + Intergenic
1019198990 6:170298448-170298470 TCCAATGAGGAAACAGAACAGGG + Intronic
1019784154 7:2963471-2963493 TATAATGAGAAAATGGAGGAAGG + Intronic
1019832860 7:3350193-3350215 GTCTATCAGAAAACATAGGATGG + Intronic
1019891885 7:3954152-3954174 TTGAATGAGAGCACAGAGGTCGG + Intronic
1020332244 7:7031748-7031770 CTCAAGGAGATAACAGAGAAAGG - Intergenic
1020533416 7:9363816-9363838 TTCAAATGGAAAACGGAGGAAGG + Intergenic
1021081650 7:16371763-16371785 TTCAAGGAGATACCAGAGAAAGG + Intronic
1021553093 7:21892681-21892703 TTCAATGAAAAAGAAAAGGAAGG - Intronic
1021585824 7:22206955-22206977 TTCAGTGAGAAAAATGAGAAAGG + Intronic
1021657147 7:22883467-22883489 TTAAAAGAGAGAACAGATGAAGG - Intergenic
1023050583 7:36247737-36247759 TTAAATGAGATCACAGAAGATGG - Intronic
1023267691 7:38425169-38425191 TTGCATCAGAAAACAGTGGAAGG + Intronic
1024385255 7:48743743-48743765 TTCATTGAGCAGCCAGAGGAGGG - Intergenic
1024791957 7:52975301-52975323 GTCAATCAGAACAAAGAGGAAGG + Intergenic
1024822019 7:53343076-53343098 TACAAAGAGAAAATAGGGGAAGG - Intergenic
1025887939 7:65615955-65615977 TACAATCAGAACACAGAAGAAGG - Intergenic
1026584458 7:71644998-71645020 TGCAGTGGGAAAAAAGAGGATGG + Intronic
1028447382 7:90941153-90941175 ATCAAGGAGAAATTAGAGGATGG + Intronic
1028491132 7:91413644-91413666 CTCAATAAGAAAAGAGTGGATGG + Intergenic
1028804903 7:95013981-95014003 TTCAAAAAGAAAAAAGAAGAAGG - Intronic
1028936753 7:96473701-96473723 ATCAAGGAGATAACAGAGAAAGG - Intergenic
1031129836 7:117819565-117819587 TTAAATGAGAAAAGAACGGAAGG + Intronic
1031133825 7:117863638-117863660 ACAGATGAGAAAACAGAGGATGG - Intronic
1031277708 7:119751429-119751451 GTGAATGAGAAAAAAGAGCAGGG - Intergenic
1031367006 7:120913780-120913802 TTCAATGAGAAAAAAGATTAAGG + Intergenic
1031854451 7:126905783-126905805 TACAATCAGAACACAGAAGAAGG + Intronic
1031885328 7:127240340-127240362 TTTAATGAGAAAATGCAGGAAGG - Intronic
1031976034 7:128094184-128094206 TTCAATTGGAAAACTAAGGAGGG - Intergenic
1032060640 7:128722142-128722164 TTCTTTCAGAAAATAGAGGAGGG - Intronic
1032204024 7:129846100-129846122 TTGAAGGAGAAAACACAAGAGGG + Intronic
1032512664 7:132484334-132484356 TTGAACGTGAAATCAGAGGAGGG + Intronic
1032982688 7:137302438-137302460 TTCAATGAGAAAAAATCAGAAGG + Intronic
1033342884 7:140505702-140505724 TAAAATCAGAGAACAGAGGAGGG + Intergenic
1033763478 7:144462241-144462263 TTCAATGAGTTGACAAAGGAAGG - Intronic
1033842333 7:145389811-145389833 GTCAATGAAAAAAGAGAGGGAGG + Intergenic
1034783470 7:153903468-153903490 TTCAATGAGAAAACTGCCCAGGG + Intronic
1035421249 7:158730455-158730477 TGCAAGGAAAATACAGAGGAAGG + Intergenic
1035569009 8:659944-659966 TTGAATGAGGACACAAAGGAAGG - Intronic
1035819994 8:2580603-2580625 TACAGTGAGAAGACAGAGGTGGG + Intergenic
1038186061 8:25275929-25275951 TAGAAAGAGAAGACAGAGGAAGG - Intronic
1038780307 8:30564359-30564381 CTCACTGGGAAAACAGAGAAAGG - Intronic
1039418002 8:37412026-37412048 AGCAAAGAGAGAACAGAGGATGG + Intergenic
1039906872 8:41792705-41792727 TGCAATGAGAGTTCAGAGGAAGG + Intronic
1040689466 8:49917729-49917751 TTGAATAAGAAAACAGAAAAGGG - Intronic
1041579685 8:59444509-59444531 TCCAATCAGAAAATAGAGAAAGG - Intergenic
1041943216 8:63411203-63411225 AGAAATGAGAAAAAAGAGGAAGG + Intergenic
1042181737 8:66095586-66095608 TTTAATGTAAGAACAGAGGAAGG - Intronic
1042338742 8:67656695-67656717 TTCAATGAGAATAGAAATGAAGG + Intronic
1042904295 8:73757426-73757448 TTCAATGAGAAAATGAATGAAGG - Intronic
1043761578 8:84075586-84075608 AACAATGAGAATCCAGAGGATGG - Intergenic
1043987926 8:86715697-86715719 ATCAAGGAGACACCAGAGGAAGG + Intronic
1044750717 8:95412877-95412899 TTAAATGAGAAGAAAGAGGAGGG - Intergenic
1044839263 8:96323921-96323943 TACAATGAGATTCCAGAGGAAGG - Intronic
1045060418 8:98406057-98406079 TACAATGGGAACATAGAGGAGGG - Intronic
1045203610 8:100013301-100013323 TTAAATGAGAACAGAGAAGAGGG + Intronic
1045296246 8:100873873-100873895 TGCACAGAGAAGACAGAGGAAGG + Intergenic
1045415441 8:101961833-101961855 TCCAAAGAAAAAACAGAGGCTGG + Intronic
1045714723 8:105027776-105027798 ATACAAGAGAAAACAGAGGATGG + Intronic
1046418332 8:113944415-113944437 TTCAGTGACAAAACAGTAGAAGG + Intergenic
1047210388 8:122835655-122835677 TTTAATGAGGAAAAAGAGGTAGG + Intronic
1047331443 8:123892259-123892281 GTAAATGGGAAAAAAGAGGATGG + Intronic
1047414181 8:124650411-124650433 TTCAGTCAGAACACACAGGATGG + Intronic
1047503293 8:125458909-125458931 TTCTGTGGGAACACAGAGGAGGG + Intergenic
1047721472 8:127644386-127644408 TTCACTGGGAAAACAGAGCCTGG - Intergenic
1047819139 8:128499429-128499451 TGTTATGAGAATACAGAGGAGGG - Intergenic
1047923044 8:129654865-129654887 TTGAATGAGACAAGAAAGGAAGG - Intergenic
1047949542 8:129919545-129919567 TGCTATGGGAAAACAGATGAGGG + Intronic
1048060256 8:130912163-130912185 TGCAATGAGAACACAGGGAAGGG - Intronic
1048194522 8:132321458-132321480 CTCAATGAGGAAGCAGAGGGAGG - Intronic
1048276304 8:133068565-133068587 TTCCATGAGAACACCCAGGAAGG - Intronic
1048754989 8:137728474-137728496 TTAAATGAGATAACAGAGTAGGG + Intergenic
1048839607 8:138553327-138553349 TTCTCTGAGAAAACAGATTAAGG + Intergenic
1049071885 8:140361929-140361951 ATCAATGGGCAAACAGAGAAAGG - Intronic
1049199655 8:141333832-141333854 TGCAATGAGGAAACTGAGGCAGG - Intergenic
1049886956 9:34138-34160 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
1050285500 9:4097475-4097497 TTCAGTGAGAAGGCAGAGGAAGG + Intronic
1050818372 9:9845277-9845299 TTCAAAGAGAAAAGAGAGAAAGG + Intronic
1050838802 9:10119859-10119881 TTGAATCAGAAAACGTAGGAGGG + Intronic
1050858465 9:10392738-10392760 TTCACTGAAAAAACAGAAAAAGG + Intronic
1051276653 9:15405340-15405362 AGCAATGAGAGAACAGAGGTGGG + Intergenic
1051394261 9:16602210-16602232 TTAAATAAGAAACCAGAAGAGGG - Intronic
1051783547 9:20717178-20717200 TACAAAGAGAAAAATGAGGAAGG + Intronic
1052044543 9:23778997-23779019 TGCTATGAGAAAGAAGAGGAGGG + Intronic
1053444812 9:38144472-38144494 TTACATGAGAAAACTGGGGAGGG + Intergenic
1054769877 9:69073704-69073726 TTAAATGAGAGAATAGAGTATGG + Exonic
1054986327 9:71266128-71266150 TACAATATGAAAACAGAGAATGG - Intronic
1055351022 9:75388537-75388559 ATAAATGAGAAAACTGAGGCAGG + Intergenic
1055356070 9:75438239-75438261 TTTAATTAGAAAGGAGAGGAAGG + Intergenic
1055834556 9:80422876-80422898 TGCTATGAGAAAACAAAGTAAGG - Intergenic
1055869601 9:80858583-80858605 TTCAAAGATAAAACAGAAAACGG + Intergenic
1055957555 9:81788346-81788368 TTCACAGAGAAAAGTGAGGAAGG + Intergenic
1056233078 9:84566817-84566839 TTCACTGAGGCAAGAGAGGATGG + Intergenic
1056482483 9:87019572-87019594 TCCAATGAGAAACAAGTGGATGG - Intergenic
1057061382 9:92006579-92006601 TTCAATGAAAAAAAAGTAGAAGG + Intergenic
1058811106 9:108640382-108640404 TTCAATGACAAAACACAGAGAGG - Intergenic
1059205603 9:112461723-112461745 ATGAATGAGAAAATAGAGCAAGG + Intronic
1059521575 9:114947357-114947379 TTCAAGGAACATACAGAGGAGGG + Intergenic
1060013720 9:120067655-120067677 TTCAACTACAAAACAGAGGAGGG + Intergenic
1060354233 9:122889530-122889552 TTCAAGAAGAAAACACAGGAGGG + Intronic
1060475358 9:123982815-123982837 CTCCATGAGAAGACAGAGAAGGG - Intergenic
1060761527 9:126254768-126254790 TTCAAAAAGAAAACAAAGGTAGG + Intergenic
1061153945 9:128845894-128845916 ATCAATGAGAAAACAGAAGGTGG + Intronic
1061704476 9:132442252-132442274 TTCAATAAGAAAAAACAGGCTGG + Intronic
1185610956 X:1393263-1393285 AGCAAAGAAAAAACAGAGGAAGG - Intergenic
1186516830 X:10172599-10172621 TCCAATGAGCAGACACAGGAAGG - Intronic
1187775377 X:22750641-22750663 TTCGATGAGAAAGCAGAAAATGG + Intergenic
1188362987 X:29279596-29279618 TTCAATATGGAAACAGAGGGAGG - Intronic
1188582274 X:31728706-31728728 TTCAAAGAGAAAAAAAAAGATGG + Intronic
1188611234 X:32100569-32100591 TGCAATGAGAAAACATAGCATGG + Intronic
1188956297 X:36438079-36438101 CTCAATGAGATACCAGGGGAAGG + Intergenic
1189061325 X:37756270-37756292 TTAGATGAGAATACAGAGAATGG - Intronic
1189256365 X:39642699-39642721 TTCAGGGAGAAAATAGAAGAGGG + Intergenic
1189596457 X:42571400-42571422 TTGAATGAGTTATCAGAGGAGGG - Intergenic
1189680516 X:43511244-43511266 TTTAATGAGAAAACAATGAATGG - Intergenic
1190990926 X:55549443-55549465 TTCATTTTGAACACAGAGGATGG - Intergenic
1191784412 X:64902647-64902669 TTCAAGGAGATACCAGAGAAAGG - Intergenic
1192032363 X:67527668-67527690 TTTAATGTGAAAACAGAGCTCGG + Intergenic
1192206176 X:69097927-69097949 TTCAATGCGAAAACACAGTGAGG + Intergenic
1192939308 X:75896191-75896213 GCCAATGAGAAACCAGGGGAAGG - Intergenic
1193266073 X:79471361-79471383 TACAAAGAGAAAATAGAGAAAGG - Intergenic
1193954529 X:87843752-87843774 CTCAATGAGATACCAGAGAAAGG - Intergenic
1194191868 X:90847675-90847697 CTCAAGGAGATAACAGAGAAAGG - Intergenic
1194262809 X:91717585-91717607 TTCAAGGAGATACCAGAGAAAGG + Intergenic
1194680846 X:96850637-96850659 TTCACAGGGAAAACATAGGAAGG + Intronic
1194737620 X:97531325-97531347 TTCTATTAGAAAACAAAGAAAGG - Intronic
1195205001 X:102589579-102589601 TACAATGATAACACAAAGGAAGG - Intergenic
1195270902 X:103229642-103229664 TTCATCAGGAAAACAGAGGAAGG + Intergenic
1195601483 X:106753642-106753664 TTCAATCAAAAAACATAGAATGG + Intronic
1196267713 X:113671178-113671200 CTAAATGAGAATGCAGAGGAGGG - Intergenic
1196598169 X:117569324-117569346 TTAAATGAGAAAACCCAGGCAGG + Intergenic
1196657953 X:118239488-118239510 TTCACTGAGTAAACAAAAGAGGG + Intergenic
1196912903 X:120501859-120501881 TGAAATTAGATAACAGAGGAAGG - Intergenic
1197049755 X:122044322-122044344 CTCAATGAGATATCAGAGAAAGG - Intergenic
1197331816 X:125161993-125162015 TCCAATGAGATATGAGAGGAAGG + Intergenic
1197677854 X:129349313-129349335 TTCAATCAGAAAGAAAAGGACGG + Intergenic
1197677873 X:129349759-129349781 CTCACTGAGAAAAGACAGGAAGG + Intergenic
1197718934 X:129731561-129731583 TTCACAGAGTAAAGAGAGGAAGG + Intergenic
1198021427 X:132662226-132662248 ATCAATGAACAAACAGATGAGGG + Intronic
1198855931 X:141016567-141016589 TTCAATCAGAAAGAAAAGGACGG - Intergenic
1198876200 X:141229544-141229566 TTCAATCAGAAAGAAAAGGATGG + Intergenic
1198906762 X:141570800-141570822 TTCAATCAGAAAGAAAAGGACGG + Intergenic
1199064553 X:143399656-143399678 TTCAAAAATAATACAGAGGATGG - Intergenic
1199321171 X:146440986-146441008 TACAAAGAGAAAACAGGGGGAGG + Intergenic
1199489713 X:148384844-148384866 ATTGATGAGAAAACTGAGGATGG - Intergenic
1199675719 X:150187655-150187677 TTAAATGAGAAAATATATGATGG - Intergenic
1199707809 X:150445872-150445894 TTCAATAAGAAAAATGAGGAAGG + Intronic
1200538507 Y:4430110-4430132 CTCAAGGAGATAACAGAGAAAGG - Intergenic
1200581873 Y:4960728-4960750 TTCAAGGAGATACCAGAGAAAGG + Intergenic
1201060954 Y:10046404-10046426 CTCAAGAAGACAACAGAGGAAGG - Intergenic
1201699124 Y:16860613-16860635 TTAAAAGAAAAAATAGAGGAAGG + Intergenic