ID: 989434233

View in Genome Browser
Species Human (GRCh38)
Location 5:41392093-41392115
Sequence AGCACTTCTGGACCTACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1158
Summary {0: 2, 1: 9, 2: 52, 3: 319, 4: 776}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989434230_989434233 15 Left 989434230 5:41392055-41392077 CCTATAAGGTTTTTGATTCTAGT 0: 1
1: 0
2: 3
3: 15
4: 192
Right 989434233 5:41392093-41392115 AGCACTTCTGGACCTACCCAAGG 0: 2
1: 9
2: 52
3: 319
4: 776

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989434233 Original CRISPR AGCACTTCTGGACCTACCCA AGG Intronic
900157323 1:1208505-1208527 TGCCCTTCTGGACGTACGCAAGG - Intergenic
901183536 1:7357754-7357776 AGTGCTTCTGGACCTTTCCATGG + Intronic
901974071 1:12930425-12930447 AGCACTGGTGGACCAGCCCACGG - Intronic
902011107 1:13271343-13271365 AGCACTGGTGGACCAGCCCACGG + Intergenic
905739959 1:40361560-40361582 GGCATTTCTGGACCTTCCCTGGG + Intronic
906870651 1:49476794-49476816 AGCATTTCTGGACCTGCCCTGGG + Intronic
906870698 1:49477109-49477131 AGCACCTCTGGACCCATGCAGGG + Intronic
906877975 1:49558672-49558694 AGCACCTCTGGACCTGCCATGGG + Intronic
908024856 1:59939680-59939702 AGTACCTCTGGACCTGCCCCAGG - Intergenic
908302278 1:62773957-62773979 AGCATTTCTGGACCTACCCTGGG - Intergenic
908598923 1:65718408-65718430 AGCACTTCTGGTCCTGCCCAGGG - Intergenic
909128598 1:71707231-71707253 GGCATTTCTGGACCTGCCCTGGG + Intronic
909128649 1:71707540-71707562 GGCAGTTTTGGACCCACCCAGGG + Intronic
909270413 1:73617094-73617116 GGCACTTCTGGACCCACTCAGGG - Intergenic
909320647 1:74281050-74281072 AGCATTTCTAGACCCACCCTGGG + Intronic
909431307 1:75590532-75590554 AGCATTTCTGAACCTGCCCTGGG + Intronic
909667639 1:78153648-78153670 GGCACTTCTGGACCCACCCAGGG - Intergenic
910102467 1:83593655-83593677 AGCATTTCTGGACCTGCCCTGGG - Intergenic
910289795 1:85588908-85588930 GGCACTTCTGGACCTGCCCTGGG + Intergenic
910289850 1:85589219-85589241 GGCATCTCTGGACCTTCCCAGGG + Intergenic
910379205 1:86608396-86608418 GGCACCTCTGGACCCACCCAGGG - Intergenic
910379253 1:86608694-86608716 AGCATATCTGGACCTGCCCTGGG - Intergenic
910818929 1:91325076-91325098 AGCATTTCTGGACCTGCCCTGGG + Intronic
911241307 1:95470618-95470640 AGCATCTCTGGACCCGCCCAGGG - Intergenic
911496510 1:98637936-98637958 GGCATTTCTGGACCTGCCCTGGG + Intergenic
911967874 1:104390306-104390328 GGCACTTGAGGACCCACCCAGGG + Intergenic
911988049 1:104656828-104656850 AGCATGTCTGGACCCAGCCAGGG - Intergenic
912034930 1:105301012-105301034 AACACTTCTGGGCCCACCCATGG - Intergenic
912316443 1:108671136-108671158 AGCATTTCTGGACCTGCACTGGG + Intergenic
912518618 1:110230791-110230813 AGCACCTCTGGGCCTGCCCAGGG + Intronic
912563035 1:110563913-110563935 AGCTCTTCTGCTCCTACCCTGGG + Intergenic
912598618 1:110904168-110904190 AGCACCTCTGGAACCACCCAGGG + Intergenic
912601198 1:110934734-110934756 GGCACCTCTGGACCTACGCAGGG + Intergenic
912633234 1:111267422-111267444 GGCATTTCTGGACCTCCCCAGGG - Intergenic
912643961 1:111373143-111373165 GGCATTTCTGGACCCACCCTAGG + Intergenic
912873108 1:113327985-113328007 AGCATCTCTGGACCTACCCTGGG - Intergenic
915005381 1:152630367-152630389 AGCATTTCTGGACCTACCCTGGG + Intergenic
915693624 1:157716257-157716279 AGCATTTCTGAACCTGCCCTGGG - Intergenic
915856852 1:159397481-159397503 GGCATTTCTGGACCTGCCCTGGG + Intergenic
915856908 1:159397792-159397814 GGCACTTCTGGACCCACCTGGGG + Intergenic
917226344 1:172788082-172788104 GGCACCTCTGGACCTACCTGGGG - Intergenic
917986547 1:180326128-180326150 AGCATCTCTGGACCCACCCAGGG - Intronic
918018671 1:180663747-180663769 AGCATCTCTGGACCTGCCCGGGG - Intronic
918358020 1:183724396-183724418 AGCATTTCTGGACGTCCCCTAGG + Intronic
918416164 1:184310735-184310757 AGTACTTCTGAACCCATCCAGGG - Intergenic
918915762 1:190634658-190634680 AGCATTTCTGAACCTACTCTGGG - Intergenic
919169820 1:193939409-193939431 GGCACTTCTAGACCTACACTGGG + Intergenic
919325390 1:196100358-196100380 GGCACTTCTGGACCCACCTAGGG + Intergenic
919336642 1:196244430-196244452 AGCATTTCTGGACCTTCCCTGGG + Intronic
919514886 1:198510824-198510846 GGCATTTCTGGACCTACCCTGGG - Intergenic
919868749 1:201804179-201804201 ATGACTTCTGGACCTACCAAAGG - Intronic
920744987 1:208617692-208617714 AGCACCTCTGGACCCACCTGGGG + Intergenic
921238740 1:213154665-213154687 AGCATTTCCGGACCTGCCCTTGG - Intronic
921296085 1:213705224-213705246 AGCACCTCTGGACCTGCCTGGGG - Intergenic
921456820 1:215380922-215380944 AATACTTCTGGACCCACCTAGGG + Intergenic
921634675 1:217477794-217477816 GGCACCTCTGGACCTACCTGGGG + Intronic
922044381 1:221929066-221929088 AGCATTTCTGGACCTGCCCTGGG + Intergenic
922358028 1:224795282-224795304 AGCATCTCTGGACCTGCCCAGGG - Intergenic
922377216 1:224980522-224980544 AGCATCTCTGGACCTATCCAGGG + Intronic
922685342 1:227634454-227634476 GGCATTTCTGGACCTTCCCTTGG + Intronic
923886602 1:238164490-238164512 AGTATTTCTGGACCTGCCCTGGG - Intergenic
924629274 1:245721692-245721714 AGCACCTCTGGACCTGCCCAGGG + Intergenic
924648971 1:245905605-245905627 AGTACTTCTGGACCCACCTGGGG + Intronic
924898841 1:248373022-248373044 AGCATTTCTGGTCCTTCCCTGGG - Intergenic
1065467685 10:26043419-26043441 GACATCTCTGGACCTACCCAGGG - Intronic
1066084528 10:31963341-31963363 AGCATTTCTGGACCTGCCTGGGG + Intergenic
1066148736 10:32591828-32591850 GGCATTTCTGGACCTACCCTGGG - Intronic
1066649649 10:37642463-37642485 AGTATCTCTGGACCTGCCCAGGG - Intergenic
1066708311 10:38204387-38204409 AGCACCTCTGAACCCACCCAGGG + Intergenic
1067808898 10:49411932-49411954 AGGACTTCTGGACCTAAGCTGGG + Intergenic
1068447950 10:57147082-57147104 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1069147909 10:64918224-64918246 GGCACATCTAGACCCACCCAGGG + Intergenic
1069343517 10:67440067-67440089 AGAATTTCTGGACTTACCCTGGG + Intronic
1069933557 10:71899972-71899994 GGCATTTCTGGGCCTACCCTGGG - Intergenic
1070464254 10:76703759-76703781 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1070915039 10:80148178-80148200 GGCATTTATGGACCTACCCTGGG + Intergenic
1071197158 10:83175095-83175117 AGCACTTCTGAACCCACCCAGGG - Intergenic
1071418495 10:85464149-85464171 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1071474381 10:86013020-86013042 TGGACATCTGGATCTACCCATGG + Intronic
1071745020 10:88407594-88407616 AGTATTTCTTGACCTACCGAAGG - Intronic
1072058861 10:91788566-91788588 AGCATTTCTGGACCCACCTAGGG + Intergenic
1072083622 10:92057194-92057216 GGCATTTCTGGACCTGCCCTGGG + Intronic
1072484589 10:95843047-95843069 AGCACATTTGGCCCTGCCCAGGG + Intronic
1072843052 10:98796255-98796277 AGCATTTCTGGACTTTCCCTGGG + Intronic
1072877755 10:99191167-99191189 AACACCTCTGGACCTACCTGGGG + Intronic
1073890149 10:108091553-108091575 GGCATTTCTAGACCTACCCTGGG + Intergenic
1074408490 10:113201878-113201900 AGCATTTCTAGACCTGCCCTGGG + Intergenic
1074638040 10:115344234-115344256 AGCACCTCTGGACCCACCAGGGG - Intronic
1074638095 10:115344544-115344566 GGCACTTCTGAACCTACCCTAGG - Intronic
1075201130 10:120405142-120405164 AGCACTTCTGGAGGTGCCCAAGG - Intergenic
1075849189 10:125573703-125573725 TGCACTTCTGGAGGTACGCATGG - Intergenic
1076094629 10:127721077-127721099 GGCATTTCTGGACCTCCCCTAGG + Intergenic
1077427452 11:2490001-2490023 AGCATTTCTGGACCTGCTCTAGG + Intronic
1077709731 11:4523696-4523718 AGTACCTCTGGACCCACCCAGGG + Intergenic
1077858880 11:6157702-6157724 AGCATTTCTGGACCTGCCCTAGG + Intergenic
1077970280 11:7181961-7181983 GGCATTTCTGGACCTTCCCTGGG + Intergenic
1079038003 11:17037329-17037351 CGCACCTCTGGACCCACCCAGGG + Intergenic
1079183527 11:18215232-18215254 GGCATTTCTGGACCTGCCCTTGG + Intronic
1079272216 11:18999406-18999428 GGTACTTCTGGATCCACCCAGGG - Intergenic
1079272265 11:18999716-18999738 AGCATTTCTGGACCTGCTCTGGG - Intergenic
1079701694 11:23556194-23556216 AGCATTTCTAGACCTTCCCTGGG - Intergenic
1079712873 11:23708382-23708404 AGCATTTGTGGACCTGCCCTGGG + Intergenic
1079729247 11:23920273-23920295 GGCACTTTTGGACCCACTCAGGG - Intergenic
1080002460 11:27364879-27364901 AGCAATGCTGGACCCCCCCAAGG + Intergenic
1080213615 11:29816709-29816731 GGCACCTCTAGACCCACCCAAGG - Intergenic
1080489816 11:32750724-32750746 AGCATCTCTGGACCTACCCTGGG - Intronic
1082114687 11:48315437-48315459 AGCACCTGTGCACCTGCCCAGGG - Intergenic
1082122680 11:48396303-48396325 GGCACCTCTGGACCCACCCAGGG - Intergenic
1082251955 11:49992368-49992390 GGCACCTCTGGACCCATCCAGGG + Intergenic
1082556383 11:54567579-54567601 GGCATCTCTGGACCCACCCAGGG - Intergenic
1082953818 11:58847428-58847450 AGCATTTCTGGACCTTCCCTGGG + Intronic
1082970226 11:59012678-59012700 AGCATTTCTGGACCTACCATGGG + Intronic
1082970271 11:59012978-59013000 AGCACCTCTGTATCCACCCAGGG + Intronic
1083512757 11:63227054-63227076 AGCATTTCTAGACCTACTCTGGG - Intronic
1085008162 11:73114346-73114368 AGCGTTTCTGGACCTGCCCTGGG - Intronic
1085087445 11:73679842-73679864 AGCACTTTGGGACCCACCCGAGG + Intronic
1085147337 11:74213068-74213090 AGCATTTCTGGACCTACCCTGGG + Intronic
1085178469 11:74511352-74511374 AGCATTTCTGGACCTGCTCTGGG + Intronic
1085223530 11:74896562-74896584 AGCATCTCTGGACACACCCAGGG + Intronic
1085372236 11:76019936-76019958 AGCATCTCTGGACCTGCTCAGGG - Intronic
1085572106 11:77568708-77568730 GGCATTTCTGGACCTGCCCTGGG - Intronic
1085651835 11:78275214-78275236 AGCCCTTCTGAACCCAGCCAAGG + Intronic
1085980539 11:81718765-81718787 AGCATCTCTGGACCTAGCCTGGG + Intergenic
1085980591 11:81719075-81719097 AGCAACTCTGAACCTACCCAGGG + Intergenic
1086033111 11:82384066-82384088 AGCATTTCTGGACCTGCCCTTGG + Intergenic
1086068786 11:82776065-82776087 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1086249719 11:84798588-84798610 AGCATTTCTGGACATTCCCTGGG - Intronic
1086468176 11:87076450-87076472 AGCATTTCTGAACCTACCCTAGG - Intronic
1086838227 11:91652797-91652819 AGCATTTCTGGTCCTGCCCTGGG - Intergenic
1087178621 11:95120082-95120104 GGCATTTCTGGACCTGCCCTGGG - Intronic
1087201338 11:95347316-95347338 AGCATTTCTGGACCTACCCTGGG + Intergenic
1087370722 11:97280135-97280157 AGCATTTCTTGACCTTCCCTGGG + Intergenic
1087472904 11:98600455-98600477 GGCAACTCTGGACCTACCCAGGG - Intergenic
1087472953 11:98600760-98600782 GGCATTTCTGGACCTTCCCTAGG - Intergenic
1087598374 11:100283000-100283022 AGCATTTCTGGACCTGCCCAGGG - Intronic
1087877012 11:103370362-103370384 AGTACCTCTGGACACACCCATGG + Intronic
1088046463 11:105457912-105457934 AGCATTTCTGGACCTGCCTGGGG + Intergenic
1088154835 11:106790405-106790427 AGCATTTCTGGACCTGCCCTGGG - Intronic
1088451993 11:109991919-109991941 AGCACCTCTAGACTTAACCATGG - Intergenic
1088570002 11:111213620-111213642 GGCACTTCTGGACCCACCTGGGG + Intergenic
1088938196 11:114425853-114425875 AGCATTTCTGGACCTACCCTGGG - Intronic
1089762187 11:120735947-120735969 AGAATTTCTGGACCTGCCCTGGG - Intronic
1089791249 11:120945851-120945873 AGCCCATCTGGCCCTAGCCACGG - Intronic
1089937099 11:122375698-122375720 GGCATTTCTGGACCTTCCCTGGG + Intergenic
1090515661 11:127423768-127423790 AGCATTTCTGGACATGCCCTGGG - Intergenic
1093124016 12:15306881-15306903 AGCATTTCTGGGCCTGCCCTGGG - Intronic
1093259490 12:16917798-16917820 GGTATTTCTGGACTTACCCAAGG - Intergenic
1093588598 12:20872343-20872365 AGCATTTCTAGACCTGCCCTGGG - Intronic
1093617231 12:21241250-21241272 AGCATTTCTGAACCTGCCCTCGG + Intergenic
1093903290 12:24661013-24661035 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1093931824 12:24961552-24961574 AGTATTTCTGGACCTGCCCTGGG + Intergenic
1093991117 12:25591153-25591175 GGCATTTCTGGACCTGCCCTAGG + Intronic
1094741706 12:33296761-33296783 AGCATTTCTGGACCTGGCCTGGG + Intergenic
1094787284 12:33863409-33863431 AGCATCTCTGGACACACCCAGGG - Intergenic
1094817652 12:34203772-34203794 GGCACTTCTGGACCCAGCCAGGG + Intergenic
1095101098 12:38184565-38184587 AGCACCTATGGACCCACTCATGG + Intergenic
1095133714 12:38572486-38572508 AGCACCTCTGGATTCACCCAGGG + Intergenic
1095169719 12:39019958-39019980 AGCACTTCTGGACCTGCCCTGGG + Intergenic
1095227607 12:39695643-39695665 AGCACTTCTGGATCCACCTGGGG + Intronic
1095400669 12:41811522-41811544 AGTACTTCTAGACCTACGAAAGG - Intergenic
1095808070 12:46343089-46343111 AACATCTCTGGACCCACCCAGGG - Intergenic
1096343937 12:50828678-50828700 AGCATTTCTGGACCTGTCCTGGG - Intergenic
1096954865 12:55516125-55516147 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1097262461 12:57727276-57727298 AGGACTTCTGCCCCTACCCACGG + Intronic
1097473173 12:60021246-60021268 AGCACTCCTGGACCCAGCCTGGG - Intergenic
1097508644 12:60507807-60507829 AGCATTTCTGGACCTACCCTGGG + Intergenic
1097563565 12:61239361-61239383 AGCACTTCTGGACCCCCCAGGGG - Intergenic
1097563619 12:61239666-61239688 GGCATTTCTGAACCTACCCTGGG - Intergenic
1097714746 12:62954543-62954565 AGAATCTCTGGACCCACCCAGGG - Intergenic
1097714800 12:62954851-62954873 AGCATTTCTGGACCTGCCCTTGG - Intergenic
1097769939 12:63572152-63572174 GGCATTTCTGGACCTGCCCTGGG + Intronic
1097791362 12:63818537-63818559 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1097830226 12:64216843-64216865 AGCAATTCTGCACCCACCAAAGG + Intronic
1097899244 12:64857007-64857029 AGCATTTCTGGACCTGCCCTGGG - Intronic
1098142845 12:67468829-67468851 AGTACCTCTGGACCCACCCAGGG - Intergenic
1098207843 12:68132203-68132225 AGCACGTCTGGACATGCCCAGGG - Intergenic
1098357984 12:69629062-69629084 TGGAATTCTGGACCTAGCCAAGG + Intergenic
1098405709 12:70123805-70123827 AGAATTTCTGGACCTGCCCTGGG + Intergenic
1098654700 12:73013395-73013417 AGCCTTTCTGGAACAACCCAGGG - Intergenic
1098667269 12:73179993-73180015 GGCACTTCTGGACCCATCCAGGG - Intergenic
1098705662 12:73685533-73685555 GGCACCTCTGTACCCACCCAGGG + Intergenic
1099024523 12:77448451-77448473 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1099100882 12:78439278-78439300 AGCACTTCTAGACCCATCCAGGG - Intergenic
1099441846 12:82708267-82708289 AGCACATCTGGACATTCTCAGGG + Intronic
1099524796 12:83705938-83705960 AGCATTTCTGGACCTGGCCTGGG + Intergenic
1099764143 12:86960741-86960763 AGCATTTCTAGACCTACCCTGGG - Intergenic
1100285707 12:93164627-93164649 AGAACTGAGGGACCTACCCAAGG + Intergenic
1100875784 12:98960022-98960044 GGCACCTCTGGACCCACCCAGGG + Intronic
1100909106 12:99338133-99338155 AGCATTTCTGGACCCATCCTGGG - Intronic
1101162556 12:101993955-101993977 TGTACCTCTGGACCTGCCCAGGG - Intronic
1101973235 12:109332415-109332437 AGCTCTTCTGGCCCTTCCTAGGG + Intergenic
1102317964 12:111905210-111905232 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1103461460 12:121108138-121108160 AGCATCTCTGGACCTTCCCAGGG + Intergenic
1105460286 13:20579250-20579272 AGCATCTCTGGACCCACCCAGGG - Intronic
1105546906 13:21357413-21357435 TGCACTTCAGGACCTCCCAATGG + Intergenic
1106349964 13:28920965-28920987 AGCATTTCTGGACCTGCCTTGGG - Intronic
1106645447 13:31629403-31629425 GGCATTTCTGGACCCACCCAGGG - Intergenic
1107808216 13:44174643-44174665 AGCATTTCTAGACCTGCCCTGGG - Intergenic
1108138022 13:47386224-47386246 GGCATTTCTGGACCTGCCCTCGG + Intergenic
1108138070 13:47386533-47386555 ATCACCCCTGGACCCACCCAGGG + Intergenic
1108922557 13:55693705-55693727 AGCACTTCTGGACCTACTCTGGG + Intergenic
1108922606 13:55694015-55694037 AGCACTTCTGGACCGACCCAGGG + Intergenic
1108962129 13:56247353-56247375 AGCATTTCTGGACCTGCCTTGGG - Intergenic
1108997034 13:56747419-56747441 AGCATTTCTGGGCCTGCCCTGGG - Intergenic
1109022692 13:57118781-57118803 AGCACCTCTGGACCTGCCTGGGG - Intergenic
1109045856 13:57409773-57409795 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1109211182 13:59537824-59537846 TGCATTTCTGGACCTTCCCTGGG - Intergenic
1109522675 13:63533684-63533706 GGCACTTCTGGACCAACTCAGGG - Intergenic
1109826431 13:67727942-67727964 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1110448759 13:75617814-75617836 AGCATTTCTGGACCTGACCTGGG - Intergenic
1110501375 13:76231882-76231904 AGCATCTCTGGACCTGCCCAGGG + Intergenic
1110886021 13:80636688-80636710 GGCATATCTGGACCTACCCAGGG - Intergenic
1110886075 13:80636962-80636984 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1110889457 13:80680115-80680137 GACACTTCTGGACCTACCTGGGG - Intergenic
1110889506 13:80680420-80680442 TGCATTTCTGGACCTGCCCTGGG - Intergenic
1110915155 13:81012080-81012102 AGCATTTCTGAACCTGCCCTGGG - Intergenic
1111379488 13:87428135-87428157 AGCCGTTCTGGACATACACATGG - Intergenic
1113244227 13:108376873-108376895 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1114072653 14:19126924-19126946 AGCATTTCTAGACCTGCCCTTGG - Intergenic
1114089604 14:19273048-19273070 AGCATTTCTAGACCTGCCCTTGG + Intergenic
1114248085 14:20933562-20933584 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1114432222 14:22671306-22671328 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1114432268 14:22671592-22671614 AGCATCTCTGGACCCACCCTGGG + Intergenic
1114761523 14:25321799-25321821 GGCACTTCTACACCTACCCAGGG - Intergenic
1114783718 14:25570067-25570089 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1114968948 14:28001761-28001783 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1114987910 14:28252710-28252732 AGCACTTCTGGACCCACTTGGGG - Intergenic
1115133980 14:30086867-30086889 AGCATCTCTGGACCTATCCAGGG + Intronic
1115661030 14:35494499-35494521 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1115861216 14:37688026-37688048 ACCATTTCTGGACCTGCCCTAGG + Intronic
1115918363 14:38342899-38342921 AGCATTTCTGGACCTGCTCTGGG + Intergenic
1115948723 14:38695088-38695110 GGCACCTCTGGACATGCCCAGGG + Intergenic
1116057888 14:39886113-39886135 GGCATTTCTGGACCTACCCTGGG + Intergenic
1116114998 14:40636296-40636318 GGCACTTCTGGACCTGCCCTGGG + Intergenic
1116121986 14:40732190-40732212 AGCATATCTGGACCTGCCCTGGG - Intergenic
1116407083 14:44579431-44579453 GGCATTTCTGGACCTTCCCCGGG + Intergenic
1116489749 14:45492133-45492155 AGTACCTCTGGACTCACCCAGGG - Intergenic
1116495321 14:45553066-45553088 AGCATTTCTAGACTTACCCTGGG - Intergenic
1116497772 14:45583148-45583170 GGCATTTCTGGACCTACCTTGGG - Intergenic
1116930723 14:50688257-50688279 AGCATTTCTGCACCTGCCCTGGG - Intergenic
1117137377 14:52750044-52750066 AACACTTCTGGTCCTACCTTGGG + Intronic
1117159358 14:52973585-52973607 ATCATTTCTGGACCTGCCCTGGG - Intergenic
1117208439 14:53469937-53469959 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1117233998 14:53752455-53752477 AGCATTTCTGGGCCTTCCCTGGG + Intergenic
1117264855 14:54076404-54076426 GCCACTTCTGTACCCACCCAGGG - Intergenic
1117264906 14:54076716-54076738 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1117384239 14:55194950-55194972 AGCATTTCTGGATCTGCCCTGGG - Intergenic
1117418383 14:55519168-55519190 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1117483047 14:56168276-56168298 AGCACTTTTGGACCCACCCAGGG - Intronic
1117606278 14:57431778-57431800 GGCACCTCTGGACCTACCTGGGG + Intergenic
1117795400 14:59388478-59388500 AGCATTTCTAGACCTGCCCTGGG - Intergenic
1117893292 14:60450255-60450277 AGCATTTCTGGACCTTCCCTGGG + Intronic
1118034145 14:61848679-61848701 AACATGTCTGGACCTTCCCATGG - Intergenic
1118543565 14:66858734-66858756 AGCATTTCTGAACCTGCCCTGGG + Intronic
1118543618 14:66859048-66859070 AGCATCTCTGGACCTACCCTGGG + Intronic
1118846017 14:69548288-69548310 AGCACAGCTGGACCTGCGCAGGG - Intergenic
1118956672 14:70489135-70489157 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1120697461 14:87659912-87659934 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1120745503 14:88147500-88147522 ACCTCTTCTGGACCCACCCGTGG + Intergenic
1120808167 14:88775346-88775368 GGCATTTCTGGACCTGCCCTGGG + Intronic
1121088517 14:91164945-91164967 GGCTCTTCTGGACTCACCCAGGG - Intronic
1121225653 14:92320086-92320108 GGTACTTCTGGACCTCCTCATGG + Intergenic
1121639037 14:95473031-95473053 AGTGCCTCTCGACCTACCCATGG - Intronic
1121759749 14:96435018-96435040 GGCATTTCTGGACCTGCCCTGGG - Intronic
1121901534 14:97697555-97697577 AGCCCATCTGGACCTACTCCTGG - Intergenic
1124613346 15:31224071-31224093 AGCACTTCCAGACCTTCTCACGG + Intergenic
1125272362 15:37953104-37953126 AGCACCTCTGGACATGCACAGGG + Intronic
1126486514 15:49187530-49187552 AGCATTTCTGGACCAATCCTGGG - Intronic
1126503824 15:49379994-49380016 GGCACCTCTGGACCCACCCAGGG - Intronic
1126503881 15:49380293-49380315 AGCATTTCTGGACCTGCCCTTGG - Intronic
1126517555 15:49553532-49553554 AGCACACCTGGACCTACCAGGGG - Intronic
1126517603 15:49553811-49553833 AGCATTTCTGGACCTGCCCTGGG - Intronic
1126706948 15:51414695-51414717 AGCACTTCTGGACCCATCCAGGG + Intergenic
1126709378 15:51440733-51440755 GGTACTTCTGGACCCACCTAGGG - Intergenic
1126979808 15:54228267-54228289 AGCATTTCTGGACCTTCCCTGGG - Intronic
1127034054 15:54895493-54895515 AGCATTTCTGGATGTACCCTGGG - Intergenic
1127035216 15:54908536-54908558 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1127132629 15:55883118-55883140 GGCATTTCTGGACCTTCCCTGGG + Intronic
1127170972 15:56300405-56300427 GGCATTTCTGGACCCACCCTGGG + Intronic
1127177950 15:56381961-56381983 AGCATCTCTGGACCCACCCAGGG - Intronic
1127178002 15:56382273-56382295 AGCATTTCTAGACTTGCCCAGGG - Intronic
1127783368 15:62335304-62335326 AGCATTTCTGGATCCACCCTGGG - Intergenic
1127971514 15:63965867-63965889 AGCATTTCTGGACCTACCCTGGG - Intronic
1128032696 15:64495659-64495681 AGCACTTCTGGGCCTCCACCTGG - Intronic
1128364503 15:66988239-66988261 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1129124179 15:73423540-73423562 AGTACTTCTGGTTCAACCCATGG + Intergenic
1129501137 15:76038650-76038672 GGCATCTCTGGACCTGCCCAGGG + Intronic
1129642474 15:77394168-77394190 GGCATCTCTGGACCTACCCAGGG + Intronic
1130441135 15:83955430-83955452 AGCATTTCTGCACCTTCCCTGGG - Intronic
1130961784 15:88664210-88664232 AGCATCTCTAGACCTGCCCAGGG + Intergenic
1131315083 15:91328870-91328892 GGCATTTCTGGACCTTCCCTTGG - Intergenic
1131959347 15:97772755-97772777 AGCACCTCTGGACGTGCCCAGGG - Intergenic
1134028362 16:10972036-10972058 AGCCCAACTGGACCCACCCAGGG + Intronic
1138433098 16:56981967-56981989 AGCAATCCTGGGCCTCCCCAGGG + Intronic
1139103798 16:63801870-63801892 AGCATTTCTGGACATACCCTGGG - Intergenic
1140158115 16:72455201-72455223 GGTATTTCCGGACCTACCCAGGG - Intergenic
1141239356 16:82250652-82250674 AGCACTTTGGGACCTTTCCATGG + Intergenic
1141485165 16:84334060-84334082 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1141485228 16:84334367-84334389 AGCATCTCTGGGCCTATCCAGGG + Intergenic
1142383053 16:89744898-89744920 TGCACTTCGGGACCTGCTCAAGG - Intronic
1143190155 17:5034660-5034682 AGCATCTTTGGACCTACCTAGGG - Exonic
1143413712 17:6729309-6729331 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1143413776 17:6729625-6729647 AGCATCTCTGGACCTCCCCAGGG + Intergenic
1146615172 17:34350732-34350754 AGCATCTCTGGACCTACCTTGGG + Intergenic
1146749938 17:35369192-35369214 AGCATTTCTGGACCCAACCTGGG + Intronic
1149108536 17:52997819-52997841 AGCATTTGTGGACCTACCCTGGG + Intergenic
1149895723 17:60426908-60426930 AGCCCCTCTGGTCCTTCCCAGGG + Intronic
1149906310 17:60529340-60529362 TGTACATCTGGACCTACCCAGGG + Intergenic
1150550436 17:66204646-66204668 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1150871096 17:68911475-68911497 GGCATTTCTGGACCCACCCTGGG + Intronic
1153075294 18:1155901-1155923 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1153099679 18:1452150-1452172 AGCACTTCTGGACCCACCTGGGG + Intergenic
1153356582 18:4143529-4143551 GGCATTTCTGGACCTTCCCTGGG - Intronic
1153363325 18:4224430-4224452 AGCATTTCTAGACCTGCCCTGGG + Intronic
1153425758 18:4961285-4961307 GGCATTTCTGGACCTTCCCTGGG + Intergenic
1153453907 18:5259854-5259876 AGCACCTCTGGACCCACTCAGGG + Intergenic
1154230732 18:12553630-12553652 AGCATCTCTAGACCTACCCCGGG + Intronic
1154386604 18:13898106-13898128 AGCATTTCTGGACCAGCCCTGGG + Intronic
1155282150 18:24250837-24250859 AACAATTCTGGACCTGCCCTGGG + Intronic
1155533816 18:26795077-26795099 GGCATTTCTGGACCTGCCCGGGG + Intergenic
1155597303 18:27502721-27502743 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1156055665 18:32999378-32999400 AGCATCTCTGGACCCACTCAGGG + Intronic
1156977187 18:43237449-43237471 AGTATCTCTGGACCTACCCATGG - Intergenic
1158024922 18:52885262-52885284 AGCATCCCTGGACCTACCCAGGG - Intronic
1158431298 18:57389818-57389840 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1158431360 18:57390126-57390148 GGCACTTCTGGACCTACCTTGGG + Intergenic
1158481200 18:57823488-57823510 AGCATCTCTGGACCCACTCAGGG - Intergenic
1158948986 18:62474628-62474650 AGCACTTCTGGACCTGCTCTGGG - Intergenic
1158949041 18:62474980-62475002 GGCACTTCTAGACATACCCTGGG - Intergenic
1159053452 18:63443033-63443055 AGGGCATCTGGACATACCCATGG - Intergenic
1159080650 18:63731661-63731683 ACCATTTCTGGATCTACCCTAGG + Intergenic
1159092004 18:63860416-63860438 ATCATTTCTGGACCTGCCCTAGG - Intergenic
1159130746 18:64277952-64277974 AGCTCTTCTGGACCCACCCTGGG - Intergenic
1159225143 18:65523681-65523703 AGCATTTCTGGACCTACCCTTGG + Intergenic
1159260237 18:66004467-66004489 AGCATTTCTTGACCTGCCCTGGG + Intergenic
1159272297 18:66168520-66168542 AGCACTTCTAGACCCACTCTGGG + Intergenic
1159394525 18:67838709-67838731 AGCATTTCTGGACCTGCCCTAGG - Intergenic
1159565029 18:70038152-70038174 AGCATCTCTGGACCTGCTCAGGG + Intronic
1159731353 18:72032662-72032684 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1159775267 18:72597646-72597668 AGCATCTCTGGACCTTCTCAGGG - Intronic
1160138385 18:76295719-76295741 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1162666703 19:12219808-12219830 AGCACTTCTGGACTCACCTGGGG - Intergenic
1162666747 19:12220093-12220115 AGCATTTCTGGACCTGTCCTGGG - Intergenic
1162692953 19:12449065-12449087 AGCACCTCTTGACCCACACAGGG - Intronic
1163225107 19:15955036-15955058 AGCAACTCTGGACCCACGCAGGG - Intergenic
1164392260 19:27835129-27835151 AGCACCTCTGAACCTACCTAGGG + Intergenic
1164408632 19:27977408-27977430 AGCACCTCTGAACCCATCCAGGG + Intergenic
1164481363 19:28613442-28613464 AGCACCTGTGGACCTCCCCTTGG - Intergenic
1164546919 19:29173697-29173719 AGCATCTCTGGACCTGCCCTGGG + Intergenic
1164643548 19:29843240-29843262 AGCACTTCTGCCCCCTCCCAGGG + Intergenic
1165964327 19:39562839-39562861 GGCACCTCTGGACCCACCCAAGG - Intergenic
1165983539 19:39747204-39747226 GGCACTTCTGGACCCACCTGGGG + Intergenic
1165984127 19:39752419-39752441 GGCACTTCTGGACCCACCTAGGG + Intergenic
1166408309 19:42539559-42539581 AACATTTCTGGACCTTCCCTGGG - Intronic
1166757360 19:45201579-45201601 GGCATTTCTGGACCTGCCCTGGG - Intronic
1166757521 19:45202562-45202584 AGCATTTCTGGACCTGCCCTGGG - Intronic
1167083151 19:47290998-47291020 AGCATTTTTGGACCTGCCCTGGG + Intronic
1167083211 19:47291306-47291328 GGCATCTCTGGACCCACCCAGGG + Intronic
1167982125 19:53284138-53284160 AGCACCTGTGGACCCACCAAAGG + Intergenic
1167984020 19:53299835-53299857 AGCACCTGTGGACCCACCAAGGG - Intergenic
1168122474 19:54259576-54259598 ATCATTTCTGGACCTGCCCTGGG - Intronic
926602110 2:14855810-14855832 GGCACTTCTGGACCCACTTAGGG + Intergenic
928293558 2:30061338-30061360 AGCATTTCTGGACCTGCCCTGGG + Intergenic
928484130 2:31712174-31712196 GGCATTTCTGGACCTTCCCTGGG + Intergenic
928495633 2:31828955-31828977 ACCATTTCTGGACCTGCCCTGGG - Intergenic
928783650 2:34854944-34854966 GGCACTTCTGGATCCACTCAGGG + Intergenic
928802979 2:35116220-35116242 GGCAACTCTGGACCTGCCCAGGG + Intergenic
928851942 2:35759025-35759047 ACAACTTCTAGACCCACCCAGGG - Intergenic
929100009 2:38302381-38302403 AGCATCTCTGGACCCACCCAAGG + Intronic
929215150 2:39404310-39404332 AGCATTTCTGGACCTGCACTGGG + Intronic
929926488 2:46216682-46216704 AACACTTCTGGACCTTACCCAGG - Intergenic
930288832 2:49467887-49467909 GGCCTTTCTGGACCTACCCTGGG - Intergenic
930439658 2:51390338-51390360 AGCATTTCTGGACCTGCCCTGGG - Intergenic
930527538 2:52548758-52548780 AGCATTTCTGGACCTGCCCTGGG + Intergenic
930727421 2:54695459-54695481 AGCATTTCTGGACCTGCCCTGGG + Intergenic
930878280 2:56244480-56244502 GGCACTTCTGTACCTACGCTGGG - Intronic
930972179 2:57409039-57409061 AGCAACTCTGGACCCACCCAGGG + Intergenic
931343622 2:61426328-61426350 GGCATTTCTGGACCTGCCCTGGG + Intronic
931343671 2:61426601-61426623 AACACTTCTGGACCCACCTGGGG + Intronic
931583035 2:63797418-63797440 GGCATTTCTGGACATACCCCAGG + Intronic
931736557 2:65199627-65199649 AGCATTTATGGACCTGCCCTGGG + Intergenic
932648729 2:73532347-73532369 AGCAATTCTGGACCTGCCTAGGG - Intronic
932648779 2:73532642-73532664 GGCATTTCTGGACCTGCCCTGGG - Intronic
932921126 2:75916546-75916568 GGCATTTCTGGACCTGCCCTAGG - Intergenic
933317041 2:80727608-80727630 GGCATTTCTGGACCTGCCCCAGG + Intergenic
933317089 2:80727909-80727931 AGCACCTCTGGACCCACTTAGGG + Intergenic
933339399 2:81003676-81003698 GGCACCTCTGGACCCACCCATGG - Intergenic
933341629 2:81033549-81033571 GGCATTTCTGGATTTACCCATGG - Intergenic
934520877 2:95019397-95019419 AGCACTCATGGCCCTGCCCATGG + Intergenic
934929004 2:98404935-98404957 AGTATTTCTGGACCTCCCCTGGG + Intergenic
935356535 2:102206846-102206868 GGCACCTCTGGATCCACCCAGGG - Intronic
935576558 2:104717323-104717345 AGCATTTCTGGACCTGCCCTGGG - Intergenic
935751022 2:106233735-106233757 AGCATCTCTGGACATGCCCAGGG + Intergenic
935812967 2:106817803-106817825 AGCACTTCTTGACCTGCCCTGGG + Intronic
936511264 2:113149499-113149521 GGCATTTCTGGACCTGCCCTGGG - Intergenic
936825375 2:116576024-116576046 GGCACTTCTGGACCCACCTTAGG - Intergenic
936885113 2:117300594-117300616 AGCACCTCTGGACCCACCCCTGG + Intergenic
936925365 2:117731174-117731196 AGCATCTCTGGACCTACCCTGGG + Intergenic
936940322 2:117878084-117878106 AGAATCTCTGGACCTGCCCATGG - Intergenic
937292943 2:120793073-120793095 AGCATTTCTGGGCCTTCCCCTGG - Intronic
937557773 2:123180529-123180551 AGCATTTCTGGAGCTGCCCTGGG + Intergenic
937560632 2:123219506-123219528 AGCACCTCTGGACCTGCCTGGGG + Intergenic
937591246 2:123615379-123615401 AGCATTTCTGGACCTGCCCTTGG + Intergenic
937736459 2:125296742-125296764 GGCACCTCTGGACACACCCAGGG - Intergenic
937739496 2:125333522-125333544 GGCATTTCTGGACCTGCCCTGGG + Intergenic
938486890 2:131720394-131720416 AGCATTTCTAGACCTGCCCTGGG - Intergenic
938619340 2:133032502-133032524 GGCACTTATGGACCCACCTAGGG + Intronic
939257169 2:139759319-139759341 GGCACTTCTGGACCCACCCAGGG - Intergenic
939273613 2:139971204-139971226 AGCATTTCTGGACCTGCCCTGGG + Intergenic
939443129 2:142275532-142275554 GGCACTTCTGGACCCACCCGGGG - Intergenic
939930696 2:148230154-148230176 GGCACCTCTGGACATGCCCAGGG - Intronic
940429754 2:153575765-153575787 GGCATTTCTGGACCTGCCCTGGG - Intergenic
940468735 2:154065269-154065291 GGCATTTCTGGACCTACTCAGGG + Intronic
940503710 2:154526985-154527007 AGCACCTCTGGACCCACTCTGGG - Intergenic
940503771 2:154527302-154527324 AGCATTTCTGGACCTTCCTTGGG - Intergenic
940509856 2:154599511-154599533 AGCACTTATAGACATACACATGG + Intergenic
940738506 2:157480423-157480445 GGCATTTCTGGACCTGCCCTGGG + Intronic
940795419 2:158072059-158072081 AGCTTTTCTGGACCTGCCCTGGG + Intronic
940947763 2:159637274-159637296 AGAATTTCTGGACCTGCCCTGGG + Intergenic
941672509 2:168310207-168310229 AACAGCTCTGGACCTGCCCAGGG - Intergenic
941678681 2:168371636-168371658 GGCACCTCTGGACCTACCTGGGG + Intergenic
942294939 2:174508041-174508063 GGCATTTCTGGACCTGCCCTAGG + Intergenic
942391765 2:175502472-175502494 AGCATTTCTGGACCTGCCCTGGG - Intergenic
942734692 2:179096715-179096737 GGCATTTCTGGACCTGCCCTGGG - Intergenic
942778467 2:179613149-179613171 AGCATTTCTGGACCTTCCCTGGG - Intronic
942814280 2:180033784-180033806 AGCATTTCTGGACCTGCCCTGGG - Intergenic
942834442 2:180277075-180277097 AGCGCCTCTGGACCTGCCCAGGG - Intergenic
942862806 2:180636273-180636295 AGCATTTCTGGACCTGCCCTGGG + Intergenic
942915023 2:181294745-181294767 GGCATTTCTGGACCTGCCCTGGG + Intergenic
942972190 2:181970676-181970698 AGCATCTCAGGACCCACCCATGG - Intronic
943067596 2:183105350-183105372 AGCATTTCTGGGCCCACCCTGGG - Intergenic
943117496 2:183691652-183691674 AGCATATCTGGACCTGCCCTGGG - Intergenic
943302754 2:186223882-186223904 GGCACTTCTGGTCATACCCTGGG + Intergenic
943309732 2:186310838-186310860 AGCATTTCTGGATCTGCCCGGGG + Intergenic
943309780 2:186311148-186311170 AGCACTTCTGGACCCACATAGGG + Intergenic
943913148 2:193593617-193593639 AGCATTTCTGGACCTGCCTTGGG + Intergenic
943933608 2:193886175-193886197 AGCATTTCTGGATCTACTCTGGG + Intergenic
944616316 2:201464695-201464717 GGCATTTCTGGACCCACCCAGGG - Intronic
944616379 2:201465008-201465030 AGCACTTCTGGACTGGCCCTGGG - Intronic
944751923 2:202717906-202717928 AACACCTCTGGACCTGCCCAGGG - Intronic
944751978 2:202718197-202718219 GGCATTTCTGGACCTGCCCTGGG - Intronic
944760404 2:202808205-202808227 GGCATTTCTGGACCTGCCCTGGG + Intronic
944855003 2:203759307-203759329 GGCATTTCTGGACCTGCCCTGGG - Intergenic
945150564 2:206785790-206785812 AACACTTCTTCCCCTACCCATGG + Intronic
945551764 2:211229322-211229344 AGCATTTCTGGACCTGCCCTGGG + Intergenic
946940562 2:224765750-224765772 AGCAACTCCGGCCCTACCCACGG - Exonic
947009113 2:225546601-225546623 GGCATTTCTGGACTTACCCTGGG - Intronic
947009211 2:225547194-225547216 GGCATTTCTGGACCTACCCTGGG + Intronic
947312330 2:228818094-228818116 AGCATTTCTGGACCTGCCCTGGG - Intergenic
947687113 2:232097659-232097681 ATCACTTCTGGACCTGCCCTGGG - Intronic
947893007 2:233643156-233643178 GGCACTTCTGGACCCACCCAGGG - Intronic
947893059 2:233643464-233643486 AGCATTTCTGGAGCTCCCCTGGG - Intronic
948335947 2:237207185-237207207 AGCACGGCTGAACCCACCCAGGG + Intergenic
948475475 2:238216240-238216262 GGCATCTCTGGACCTACCCTGGG - Intergenic
1168917210 20:1500016-1500038 AGCATTTCTAGACCTATCCTGGG - Intergenic
1170086890 20:12544090-12544112 GGCACTTCTGGATACACCCAAGG - Intergenic
1170478509 20:16741891-16741913 TCCACTTCTGGAGATACCCATGG - Exonic
1171162316 20:22938984-22939006 AGCATTTCTGGCCCTTCCCATGG + Intergenic
1171779485 20:29406108-29406130 GGCACTTCTGGACCCAGCCAGGG + Intergenic
1171820647 20:29834679-29834701 GGCACTTCTGGACCCAGCCAGGG + Intergenic
1171822936 20:29871826-29871848 GGCACTTCTGGACCCAGCCAGGG + Intergenic
1171897181 20:30818490-30818512 GGCACTTCTGGACCCAGCCAGGG - Intergenic
1172120665 20:32596904-32596926 AGCCCTTCTGGATCACCCCAAGG - Intronic
1172419070 20:34798356-34798378 AACATCTCTGGACCCACCCAGGG + Intronic
1173098944 20:40065576-40065598 AGCACTTTTGAACCTACCATGGG + Intergenic
1174938562 20:54898594-54898616 AGCATTTCTGGACCTGCCCTAGG + Intergenic
1175616970 20:60408008-60408030 AGCCCTTCTGCACTGACCCAAGG - Intergenic
1175632109 20:60550022-60550044 GCCATTTCTGGACCTACCCAGGG - Intergenic
1175695177 20:61097836-61097858 AGCACTGTGGGACCTCCCCAAGG - Intergenic
1175958495 20:62623344-62623366 AGCACTTCAGAGCCTTCCCAGGG + Intergenic
1176873741 21:14105216-14105238 AGCACCTCTGAACCAACCTAGGG - Intergenic
1176876698 21:14136608-14136630 AGTACTTCTGGATCCACTCAGGG + Intronic
1176917635 21:14645053-14645075 TGCACTTCTGGACTCACCCAGGG + Intronic
1176939859 21:14911445-14911467 AGCATTTCAGGACCTGCCCAGGG - Intergenic
1177132993 21:17279852-17279874 AGCATCTCTGGACCTGCCCTGGG + Intergenic
1177222168 21:18209125-18209147 AGCATCTCTGGATCTGCCCAGGG - Intronic
1177222216 21:18209438-18209460 AGCATTTCTGGACCTCTCCTAGG - Intronic
1177401064 21:20605934-20605956 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1177456392 21:21344669-21344691 AGCACCTCTGGACCCACCTGGGG + Intronic
1177487928 21:21783137-21783159 TGAACCTCTGGACCTTCCCAGGG - Intergenic
1177569625 21:22870780-22870802 GGAACTTCTGGACCTTCCCTGGG - Intergenic
1177578016 21:22983298-22983320 AGCACTTCTGGACCCGCCCAGGG + Intergenic
1177692831 21:24532758-24532780 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1177761414 21:25406554-25406576 TGCACTTCAGGACCCATCCAGGG - Intergenic
1179435664 21:41360548-41360570 GGCACCTCTGGTCCTTCCCAGGG + Intergenic
1180324681 22:11359628-11359650 GGCTCTTCTGGACCCAGCCAGGG + Intergenic
1180491099 22:15849299-15849321 AGCATTTCTAGACCTGCCCTTGG - Intergenic
1181717000 22:24738291-24738313 GGCATTTCTGTACCTGCCCAGGG + Intronic
1183497220 22:38153832-38153854 GGCAGTTCTGGACCTGCCCTGGG + Intronic
1184046158 22:41973407-41973429 AGCACTTTGGGATCTGCCCAAGG + Intergenic
949235624 3:1805688-1805710 GGTACCTCTGGACCTGCCCAGGG - Intergenic
949743084 3:7258856-7258878 AGCACTTGTGTACCTGCTCAAGG - Intronic
950927758 3:16759803-16759825 AGCATTTCCGGACCTGCCCTGGG - Intergenic
951032164 3:17895012-17895034 GGCAGTTCTGGACCCACCCAGGG - Intronic
951102385 3:18703782-18703804 GGCACCTCTGGGCCCACCCAGGG + Intergenic
951181945 3:19669124-19669146 AGCATTTCTGGACCTGCCCTGGG + Intergenic
951181993 3:19669422-19669444 GGCATCTCTGGACCTGCCCAGGG + Intergenic
951204437 3:19910492-19910514 AGTACTTCTGTACCCACCCAGGG + Intronic
951259843 3:20494991-20495013 AGCATCTCTGGACATGCCCAAGG - Intergenic
951310265 3:21116930-21116952 AGCATTTCTGGACCTTCCCTGGG - Intergenic
951423191 3:22511299-22511321 GGCACCTCTGGACCTACCTGGGG + Intergenic
951435387 3:22656991-22657013 GGCACCTCTGGACCTGCACAGGG - Intergenic
951435437 3:22657288-22657310 AGCATTTCTGGATCTGCCCTGGG - Intergenic
951794511 3:26523687-26523709 AGCATTTCTGGACCTGCCCTGGG - Intergenic
951904367 3:27689149-27689171 GGCACTTCTAGACCCACCCAGGG + Intergenic
952066429 3:29576894-29576916 AGCATTTCTGGACCTGCCCTGGG - Intronic
952203114 3:31151550-31151572 GGCATTTCTGGACCTTCCCTGGG - Intergenic
952673082 3:35994374-35994396 AGCATCTCTGAACCCACCCAGGG + Intergenic
953217244 3:40930915-40930937 AGCATTTCTGGACCTGCCCTGGG + Intergenic
953362388 3:42309411-42309433 AGCATTTCTGGACCTGCTCTGGG - Intergenic
955274353 3:57533248-57533270 GGCATTTCTGGACCTGCCCTGGG - Intronic
956222995 3:66923778-66923800 AGCATTTCTAGACCTGCCCTGGG + Intergenic
956223045 3:66924088-66924110 AGCATTTCTGGATACACCCAGGG + Intergenic
956476139 3:69621976-69621998 GGCATTTCTGGACCTGCCCTGGG + Intergenic
957085660 3:75674544-75674566 GGCATTTCTGGACCCAGCCAGGG - Intergenic
957745755 3:84340034-84340056 AGCATTTCTAGACCCACCCTGGG - Intergenic
957915889 3:86687352-86687374 AACACTTCTGGACCAACCTGAGG + Intergenic
957925464 3:86805257-86805279 AGTGTTTCTGGACCTGCCCAGGG + Intergenic
958099399 3:88989416-88989438 GGCATTTCTGGACCTTCCCTAGG + Intergenic
958147146 3:89640215-89640237 AGCATTTCTGGACCTGCCCTGGG + Intergenic
958682905 3:97353664-97353686 AGCATTTCTGGACCTACCATGGG + Intronic
958765308 3:98360600-98360622 GGCATTTCTGGACCTGCCCTGGG - Intergenic
958876758 3:99625230-99625252 AGCACCTCTGGACTTACCTGGGG + Intergenic
959041997 3:101432330-101432352 AGCACTTCTGGACTGACCAAGGG + Intronic
959118540 3:102206351-102206373 GGCATTTCTAGACATACCCAGGG - Intronic
959191178 3:103113292-103113314 AGCATTTCTGGACCTGCCCTGGG + Intergenic
959215927 3:103449837-103449859 AGCAATTCTGGACCTGCCTAGGG + Intergenic
959279320 3:104317442-104317464 GGCACTTCTGGACCTACCCAGGG + Intergenic
959303977 3:104636245-104636267 GGCACTTCTGGACCCACTCAGGG + Intergenic
959409041 3:105997656-105997678 AGCATTTCTGGACATGCCCTGGG - Intergenic
959435840 3:106314307-106314329 AGCATTTCTTGACCTGCCCTGGG - Intergenic
959547371 3:107612849-107612871 AGCATCTCTGGACCCACCCAGGG - Intronic
959761979 3:109976747-109976769 AGCATTTCTGGACCTGTCCTGGG - Intergenic
959841716 3:110984095-110984117 AGCATCTCTGGAACTTCCCATGG + Intergenic
959868510 3:111299957-111299979 GGCAATTCTGGACCCACCCTGGG - Intronic
959913647 3:111793139-111793161 AGCAATTCTGGACCTGCCCTGGG - Intronic
960016449 3:112894635-112894657 AGCATTTCTAGACCTGCCCTAGG + Intergenic
960404167 3:117238929-117238951 AGCATTTCTGGACCCACTCTGGG + Intergenic
960490770 3:118314270-118314292 AACATTTCTGGACCTGCCCTGGG + Intergenic
960541118 3:118863971-118863993 GGTACCTCTGGACCCACCCAGGG - Intergenic
960668367 3:120132720-120132742 AGCTCTTCTGGAGCTCCTCAGGG + Intergenic
960681291 3:120249925-120249947 AGCATTTCTGGACCTTCCCTGGG + Intronic
960862677 3:122167949-122167971 TGCATTTCTAGACCTGCCCAGGG - Intergenic
960870037 3:122239150-122239172 AGCATTTCTGGACCTGCCATGGG + Intronic
961986244 3:131138140-131138162 AGCATTGCTGGACCTTCCCTGGG + Intronic
962078709 3:132114437-132114459 GGCACTTGTGGTCCTACCCTGGG - Intronic
962151958 3:132902809-132902831 AGCATTTCTGAACCTATCCTGGG + Intergenic
962256015 3:133870864-133870886 AGCTCCTCTGGACATCCCCATGG - Intronic
962288699 3:134110577-134110599 AGCTTTTCTGGGCCTGCCCAAGG + Intronic
962483347 3:135816708-135816730 AGCATTTCTGGACTTGCCCTGGG + Intergenic
963310159 3:143700706-143700728 AGCACCTCTGGACACATCCAGGG + Intronic
963354811 3:144197774-144197796 AGCATTCCTGGACCTGCCCTCGG - Intergenic
963591858 3:147270274-147270296 AGCACTCCTGGAACCATCCAAGG + Intergenic
963692331 3:148519781-148519803 TGCACCTCTGGACCCATCCAGGG + Intergenic
963763335 3:149307759-149307781 GGCATTTCTGGACCTGCCCTGGG - Intergenic
964059524 3:152504958-152504980 GGCACTTCTGGACCCACCCAGGG - Intergenic
964059575 3:152505267-152505289 AGCATTTCTGGACCTGTCCTGGG - Intergenic
964151674 3:153532615-153532637 GGCATTTCTGGACCTACCCTAGG + Intergenic
964179424 3:153865559-153865581 AGCACTCCTGGACCTTCCCTGGG + Intergenic
964209287 3:154210160-154210182 GGCATTTCTGGACCTGCCCTGGG - Intronic
964318140 3:155465712-155465734 AGCATTTCTGGACCTGCCCTGGG + Intronic
964810107 3:160654335-160654357 AGCATTTCTGGACCTGCCCTGGG + Intergenic
964810170 3:160654646-160654668 AGCATCTCTGGACATGCCCAGGG + Intergenic
964871717 3:161319893-161319915 GGCATTTCTGGACCTGCCCTGGG + Intergenic
964871766 3:161320203-161320225 GGCACATCTGGACCTTCTCAGGG + Intergenic
964992304 3:162828882-162828904 AGCACTTCTGAATGTACCCTGGG + Intergenic
964992866 3:162835709-162835731 AGCATTTCTGGATCTACCCTGGG - Intergenic
965047577 3:163598477-163598499 GGCATTTCTGGACCCACTCAGGG + Intergenic
965175223 3:165322303-165322325 GGCATTTCTAGACCTACCCCAGG - Intergenic
965260548 3:166478367-166478389 AGCACCTCTGGACCCACCGAGGG + Intergenic
965273769 3:166653749-166653771 ACCACCTCTGGACTCACCCAGGG + Intergenic
966313027 3:178615687-178615709 GGCATTTCTGGACCTGCCCTAGG - Intronic
966348578 3:179005078-179005100 GGCATTTCTGGACCTGCCCTGGG + Intergenic
966401008 3:179546864-179546886 AACATCTCTGGACCTGCCCAGGG + Intergenic
966445196 3:179994540-179994562 AGCCCCTCTGGCCCTATCCAGGG - Intronic
966453917 3:180093820-180093842 AGCATTTCTGGACCTGCCCTGGG - Intergenic
966491154 3:180529895-180529917 AGCTCCTCTGGACTCACCCAGGG + Intergenic
967655564 3:192044063-192044085 AACATTTCTGGACCTGCCCTGGG + Intergenic
968004968 3:195236508-195236530 AGCATTTCTGGACCTACCCCAGG - Intronic
968334556 3:197901769-197901791 AGCATCTCTGGACCCGCCCAGGG + Intronic
970071201 4:12161958-12161980 GGCATTTCTGGACCTGCCAAGGG - Intergenic
970413345 4:15832831-15832853 GGCACCTCTGGACCAACCCAGGG - Intronic
970413400 4:15833139-15833161 AGCATTTCTGGGCCTGCCCTGGG - Intronic
970667455 4:18353985-18354007 GGCATTTCTGGACCTGCCCTGGG - Intergenic
970963370 4:21898877-21898899 AGCATTTCTGGACCTGCCCAGGG + Intronic
971095644 4:23399249-23399271 GGCATTTCTGGACCTTCCCTGGG - Intergenic
972021651 4:34323348-34323370 AGCATTTCTGGACCTGCCCTGGG + Intergenic
972237378 4:37150106-37150128 GGTACTTCTGGACCCACCCTGGG - Intergenic
972468752 4:39383991-39384013 AGCATTTCTGGACCTGCTCTGGG - Intergenic
972851628 4:43057487-43057509 AGCATTTCTGGACTTGCCCTTGG + Intergenic
972851677 4:43057795-43057817 GGCAATTCTGGACCCACCCAGGG + Intergenic
972856546 4:43114186-43114208 AGCATTTCTGGACCTGTCCTGGG + Intergenic
972928458 4:44040943-44040965 AGCATTTCTGGACTTGCCCTGGG + Intergenic
973227461 4:47802342-47802364 AGCATTTCTGGACCTGCCCTGGG + Intronic
973300781 4:48581419-48581441 TGCACTTCTGGAAATACCTAAGG - Exonic
973327368 4:48877424-48877446 AGCATCTCTGGACCTGCCTAGGG - Intergenic
974267018 4:59598599-59598621 AGCATTTCTGGACCTTCACAGGG + Intergenic
974298962 4:60040469-60040491 AGCATTTCTGGACCTGCCCTGGG - Intergenic
974414946 4:61595081-61595103 AGCATTTCTGGACCTGCTCTAGG - Intronic
974469677 4:62302502-62302524 AGCACTTCTGGATCTTCTCTGGG + Intergenic
974593237 4:63983252-63983274 AGAAGTTCTGGACCTGCCCTGGG - Intergenic
974780160 4:66543960-66543982 AGCATCTCTGGACCTGCCCTGGG + Intergenic
974893237 4:67907229-67907251 GGCATTTCTGGACCTTCCCTGGG - Intergenic
975081013 4:70280723-70280745 AGCATTTCTGGACCTGCCATAGG + Intergenic
975095256 4:70450055-70450077 AGCACTTCTGGACCCATCTGGGG - Intronic
975180027 4:71333927-71333949 AGCATTTCTGGACCTGCCCTGGG - Intronic
975252790 4:72198657-72198679 GGTACTTCTGGATCCACCCAGGG + Intergenic
975365557 4:73524010-73524032 AGCATTTCTGGACCTGCCCTGGG - Intergenic
975369425 4:73567849-73567871 AGCATCTCTGGACTCACCCATGG - Intergenic
975741016 4:77429028-77429050 AGCACTTCTACCCCTGCCCAGGG + Intronic
976041110 4:80885935-80885957 AGCATTTCTGGACCTGCCCTGGG + Intronic
976082813 4:81375297-81375319 AGCATTTCTGGACCTTCCCTGGG - Intergenic
976128717 4:81860800-81860822 AGCATTTCTGGACCTGCCCTGGG + Intronic
976171697 4:82311120-82311142 GGCATTTCTGGACCTATCCTGGG - Intergenic
976444179 4:85111010-85111032 GGCATCTCTGGACCTGCCCAGGG + Intergenic
976451847 4:85199543-85199565 AGCATCTCTGGACCTGCCCGGGG - Intergenic
976908252 4:90267072-90267094 AGCATTTCTAGGCCTACCCTGGG + Intronic
976943729 4:90738882-90738904 GGCATTTCTGGACCTGCCCTGGG - Intronic
977074149 4:92432349-92432371 GGCATTTCTGGACCCACCCTGGG - Intronic
977166855 4:93710685-93710707 AGCACTTCAAGACCCACCCTGGG - Intronic
977325628 4:95571915-95571937 AGCATTGCTGGACCTGCCTAGGG - Intergenic
977341577 4:95764635-95764657 GGCATTTCTGGACCTGCCCTGGG + Intergenic
977458582 4:97296187-97296209 AGCATTTCTGGACATGCACAGGG - Intronic
977521851 4:98094571-98094593 AGCATTTCTGGACCTGCCCTGGG + Intronic
977527812 4:98165997-98166019 AGCATTTCTGGACCTTCCCTGGG - Intergenic
977873670 4:102123814-102123836 AGCATTTCTGGACTTGCCCTAGG - Intergenic
978030991 4:103939602-103939624 GGCACTTCTGGACCCACCCAGGG + Intergenic
978082868 4:104616134-104616156 AGTATCTCTGGACCTGCCCAGGG - Intergenic
978212640 4:106156777-106156799 AGCATTTCTGGACCTGCCGTGGG - Intronic
978261801 4:106768691-106768713 AGCACCTCTGGACCTGCCAGGGG + Intergenic
978654389 4:111049102-111049124 GGCATTTCTGGACCTGCCCTGGG + Intergenic
979413539 4:120407318-120407340 AGCACTTCTGGACACACCTGGGG + Intergenic
979504380 4:121479444-121479466 AGCATCTCTGGACCTGCTCAGGG - Intergenic
979565050 4:122145585-122145607 AGCATTTCTGGACCTGCCCTGGG - Intergenic
979573010 4:122252382-122252404 GGCATTTCTGGACCTGCCCTGGG + Intronic
979594977 4:122525106-122525128 GGCATTTCTGGACCTACCCTGGG - Intergenic
979878823 4:125928725-125928747 AGCATTTCTGGACCTGGCCTAGG + Intergenic
979945849 4:126830410-126830432 AGCACTTTTGAACCTGCCCTAGG + Intergenic
980172378 4:129305657-129305679 AGCATTTCTGGACCTGCCCTGGG - Intergenic
980442530 4:132867468-132867490 AGCATTTCTGGGCCTGCCCTGGG + Intergenic
980442974 4:132871419-132871441 AGCATTTCTGGACCTGCCTTGGG + Intergenic
980657707 4:135811555-135811577 AGCATTTCTGGACCTGCCCTTGG + Intergenic
980660746 4:135855093-135855115 AGAACTTCTGGACCCACCTGGGG - Intergenic
980660795 4:135855401-135855423 GGCATTTCTGGACCTGCCCTGGG - Intergenic
980960487 4:139470154-139470176 GGTACTTCTGGACCAACCCAAGG - Intronic
980960545 4:139470465-139470487 AGCATTTTTGGACCTGCCCTGGG - Intronic
981286523 4:143025046-143025068 AGCACTTCTAGACCCACCCTGGG + Intergenic
981298040 4:143155890-143155912 GGCACCTCTGGACGTGCCCAGGG - Intergenic
981329228 4:143488782-143488804 AGCATTTCTGAACCTGCCCTGGG + Intergenic
981518333 4:145634475-145634497 GGCATTTCTGGACCTGCCCTGGG - Intronic
981530792 4:145752062-145752084 AGCATTTCTGGACCTGCCCTGGG - Intronic
981836993 4:149065553-149065575 AGCTTTTCTGGACCCACCCTGGG + Intergenic
981870975 4:149486222-149486244 AGCATCTCTGGACACACCCAGGG - Intergenic
981895669 4:149796141-149796163 AGCATTTCTGGACCTGCCCTGGG + Intergenic
981996171 4:150977630-150977652 AGCATTTCTGGACATGCCCTGGG + Intronic
982156817 4:152531596-152531618 AGCACTACTGTGCCTACACAGGG + Intronic
982615369 4:157634162-157634184 AGCACTTCTGGACCCGCCTACGG + Intergenic
982683361 4:158459079-158459101 AGCATTTCTGGACCTGCCCTAGG - Intronic
982828234 4:160027100-160027122 AGCATCCCTGGACCCACCCAGGG - Intergenic
983165946 4:164477475-164477497 GGCATTTCTGGACCTTCCCTGGG - Intergenic
983683904 4:170385163-170385185 GGCATCTCTGGACCTGCCCAGGG - Intergenic
983931851 4:173461111-173461133 GGCACTTCTGGGCCCACCCGGGG + Intergenic
985444353 4:190012981-190013003 GGCACTTCTCGACCCAGCCAGGG + Intergenic
986544431 5:8880022-8880044 AGCATTTCTGGACCTGCCCTGGG - Intergenic
986885223 5:12225952-12225974 AGTATTTCTGAACCTACCCTGGG - Intergenic
987096304 5:14553579-14553601 GGCACTTCTGTCCCTACCAAAGG - Intergenic
987163987 5:15174424-15174446 GGCATTTCTGGACCTTCCCTGGG + Intergenic
987496561 5:18652728-18652750 GGCATTTCTGGACCTTCCCTGGG - Intergenic
987537425 5:19206849-19206871 AGCATTTCTGGACCTTCTCTGGG + Intergenic
987564356 5:19565081-19565103 AGCATTTCTAGACCTGCCCTGGG + Intronic
987773030 5:22330883-22330905 AGCATTTCTGGACATACCATGGG + Intronic
987823128 5:22991596-22991618 GGCATTTCTGGACCTGCCCTAGG + Intergenic
987911721 5:24155309-24155331 GGCAGTTCTGGACCTGCCCTGGG + Intronic
987953111 5:24701901-24701923 AGCATTTCTAGACCTGCCCTGGG - Intergenic
988001763 5:25358622-25358644 AGCACTTCTGGACCTGCCCTGGG + Intergenic
988039819 5:25874638-25874660 GGCATGTCTAGACCTACCCAGGG - Intergenic
988082750 5:26433928-26433950 AGCACTTCTGGACCTACCCTGGG + Intergenic
988265257 5:28941461-28941483 GGCATTTCTGGACCTGCCCAGGG - Intergenic
988299511 5:29404170-29404192 GGCATTTCTGGACCTACCCTGGG + Intergenic
988340140 5:29960358-29960380 AGGATTTCTGGACCTGCCCTGGG + Intergenic
988384215 5:30540031-30540053 AGCATTTCTAGACCTGCCCTTGG + Intergenic
988608344 5:32702133-32702155 GGCATCTCTGAACCTACCCAGGG - Intronic
988765314 5:34367274-34367296 AACACTTTTGGAGCTTCCCATGG + Intergenic
989427827 5:41316589-41316611 GGCATTTCTGGACCTGCCCAGGG + Intronic
989427879 5:41316896-41316918 GGCACTTCTGGACCCACCCAGGG + Intronic
989434233 5:41392093-41392115 AGCACTTCTGGACCTACCCAAGG + Intronic
989628985 5:43461519-43461541 GGCATTTCTGGACCTGCCCTGGG + Intronic
989723025 5:44552429-44552451 AGCACCTATGGACCCATCCAGGG - Intergenic
990578910 5:57150011-57150033 GGCATCTCTGGACCCACCCAGGG - Intergenic
990899966 5:60739396-60739418 AGCATTTCTGGACCTACCCTGGG + Intergenic
990922198 5:60979704-60979726 GGCATCTCTGGACCTGCCCAAGG + Intronic
991018497 5:61956629-61956651 AGCACTTCTGGACCCACCCAGGG - Intergenic
991205275 5:64042504-64042526 AGCATTTCTGGACCTGCTCTGGG + Intergenic
991395283 5:66198447-66198469 AGCATTTCTAGACCTACCCTGGG - Intergenic
991663643 5:68974664-68974686 GGCATTTCTGGACCTGCCCTGGG + Intergenic
991682108 5:69149973-69149995 AGCATTTTTGGACCTACCCCGGG - Intergenic
991693765 5:69250592-69250614 GGCATTTCTGGACCTACCCCTGG - Intronic
992284975 5:75225890-75225912 AGCATTTCTGGACCTGCCCTGGG + Intronic
992291447 5:75283796-75283818 AGCATTTCTGGACCCACCCCGGG + Intergenic
992657261 5:78922782-78922804 AGCATTTCTGGAGCTGCCCCTGG + Intronic
993192148 5:84696390-84696412 AGGAGTTCTGGAACTGCCCAGGG + Intergenic
993257088 5:85605353-85605375 GGCATTTCTGGACCTACCCTGGG + Intergenic
994028636 5:95114701-95114723 GGCACCTCTGGACCTGCCCAGGG + Intronic
994264649 5:97700394-97700416 AGCATTTCTGAACCTGCCCTGGG + Intergenic
994457337 5:100028107-100028129 GGGATTTCTGGACCCACCCAGGG + Intergenic
994477657 5:100290939-100290961 GGCATTTCTGGACCAACCCTGGG - Intergenic
994616158 5:102107207-102107229 GGCATTTCTGGACCTACCCTGGG - Intergenic
994633872 5:102320341-102320363 GGCACTTCTGAACTCACCCAGGG - Intergenic
994633915 5:102320624-102320646 AGCATTTCTGGAACTACCCTGGG - Intergenic
995278560 5:110307190-110307212 GGCATTTCTGGACCTGCCCTGGG - Intronic
995371915 5:111427778-111427800 AGCACTTCTGGACCCAGCGGGGG + Intronic
995514849 5:112944164-112944186 TGCATTTCTGGACCCACCCTGGG + Intergenic
995557558 5:113344994-113345016 AGCATTTCTGGACCTGCCCCGGG + Intronic
996161644 5:120173929-120173951 AGCATTTCTGGAACTGCCCTGGG + Intergenic
996166348 5:120228639-120228661 AGCATCTCTGAACCTGCCCAGGG - Intergenic
996192536 5:120563648-120563670 AGCATTTCTGGACCTGTCCAGGG - Intronic
996666583 5:126066816-126066838 AGCACTTCTGGACCTGCCCTGGG + Intergenic
996927606 5:128846540-128846562 AGCACTGCTGGACCCATCCAGGG + Intronic
996968357 5:129331998-129332020 AGCACCTCTGGTCCTACCTGGGG + Intergenic
997059903 5:130488562-130488584 AGCATCTCTAGACCCACCCAGGG + Intergenic
997071978 5:130633207-130633229 GGCATTTCTGGACCTTCCCTGGG - Intergenic
997186316 5:131885070-131885092 AGCCACTCTGGACCTGCCCAGGG + Intronic
997832670 5:137164647-137164669 AGCATTTCTGGACCTGCCCTGGG + Intronic
998058163 5:139096920-139096942 GACATTTCTGGACCTACCCTGGG + Intronic
998291124 5:140915896-140915918 AGCATCTCTGGGCCTGCCCAGGG - Intronic
998689324 5:144570170-144570192 AGCATTTCTAGACCCACCCTTGG - Intergenic
998695283 5:144631187-144631209 AGCACTTCTGCACCCACCCAGGG + Intergenic
998716475 5:144889962-144889984 AGCACTACTGGACCTATCTGGGG + Intergenic
1000270245 5:159677264-159677286 AGCATTTCTGGACCTGCCCTCGG + Intergenic
1000399490 5:160811410-160811432 AGCATTTCTGGATCTGCCCTGGG + Intronic
1000433552 5:161180178-161180200 AGCATTCCTGGACCCACCCTGGG + Intergenic
1000454945 5:161437629-161437651 AGCATTTCTGGACCTGCCCTGGG + Intronic
1000455001 5:161437938-161437960 GGCACTTCTGGACCCACCTGGGG + Intronic
1000478626 5:161744082-161744104 AGCATTTCTGGACCTTCCCTGGG - Intergenic
1001177725 5:169487298-169487320 AGCACCCCTGGACATGCCCAGGG + Intergenic
1001845407 5:174917351-174917373 AGCATTGCTGGACCTGCCCTGGG + Intergenic
1002129598 5:177072242-177072264 AGCACTTCTGCTCATTCCCAAGG + Intronic
1003404781 6:5819304-5819326 TGCACTTCAGGACCTCCCAATGG - Intergenic
1003437895 6:6111069-6111091 AGCACTATTGGACCTGCCTAGGG - Intergenic
1005037387 6:21569464-21569486 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1005156995 6:22818843-22818865 AGCATCTCTGGACTTACCCAGGG - Intergenic
1006963752 6:37961134-37961156 GGCATTTCTGGACCTGCCCTGGG + Intronic
1008177550 6:48287708-48287730 GGCACTTCTGGACCCACCCAGGG - Intergenic
1008238964 6:49084901-49084923 GGCATCTCTGGACCTGCCCAGGG + Intergenic
1008822520 6:55650953-55650975 AGCATTTCTGGGCCTACCCTGGG - Intergenic
1008857960 6:56113794-56113816 AGCATTTCTGGACCTGCCTTGGG + Intronic
1008880832 6:56378617-56378639 AGCACCTCTGGACCTGCCTGGGG + Intronic
1009309080 6:62126387-62126409 AGCATCTCTGGACCTGCCTAGGG + Intronic
1009353138 6:62707485-62707507 GGCATTTCTGGACCTTCCCTGGG - Intergenic
1009371183 6:62905456-62905478 AACATTTCTGGACCTGCCCCGGG + Intergenic
1009371237 6:62905768-62905790 AGCATCTCTGGACTTACCCAAGG + Intergenic
1009687785 6:66986407-66986429 AACATTTCTGGACCTGCCCTGGG - Intergenic
1009978497 6:70699813-70699835 GGCATTTCTGGACCCACCCTGGG - Intronic
1010139861 6:72601896-72601918 AGCACCTCTGGACCTGCTCAGGG - Intergenic
1010299485 6:74243498-74243520 AGCAATTCTAGACCTACCCTGGG - Intergenic
1010325132 6:74555267-74555289 GGCACTTCTGGACTTACCCCGGG + Intergenic
1010328085 6:74588157-74588179 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1010502219 6:76615142-76615164 AGCATTTCTGGACATGCCCAGGG + Intergenic
1010514252 6:76753714-76753736 GGCATTTCTGGACCTACCCTGGG + Intergenic
1010528905 6:76942268-76942290 AGCATTTATGGACCTGCCCTGGG + Intergenic
1010548073 6:77183745-77183767 AGCACCTCTGGACTCACCTAGGG + Intergenic
1010625384 6:78131884-78131906 GGCACTTCTGGACCCAGCCGGGG + Intergenic
1011023940 6:82845695-82845717 AGCATTTCTGGACTTGCCCTGGG + Intergenic
1011232528 6:85178749-85178771 AACACTTCTGGAACCACCCAGGG - Intergenic
1011333207 6:86233473-86233495 AGAACTTCTGGACCTGCCCTGGG - Intergenic
1011343264 6:86340684-86340706 AACATTTCTGGACCTACTCTGGG + Intergenic
1011386267 6:86801801-86801823 AGCATTTCTGGACCTTCCCAGGG - Intergenic
1011791831 6:90907150-90907172 AGCATTTCTGGACCTGCACTGGG - Intergenic
1012073697 6:94657117-94657139 AACACATCTGGACCTACCTGGGG - Intergenic
1012483109 6:99689935-99689957 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1012486232 6:99725130-99725152 AGCATTTCTGGACCTGCCATGGG - Intergenic
1012679010 6:102154538-102154560 AGCAACTTTGGACCTACCCATGG + Intergenic
1012807081 6:103908289-103908311 AGCATTTCTGGACCTACCCTGGG - Intergenic
1012824096 6:104125929-104125951 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1013375525 6:109510162-109510184 GCCTCTTCTGGGCCTACCCAGGG + Intronic
1013925556 6:115467895-115467917 GGCACTTCTGGATCCACACAGGG - Intergenic
1014583057 6:123162033-123162055 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1014728634 6:125004561-125004583 AACACTTCTGTACCTACCTTTGG - Intronic
1014862336 6:126485055-126485077 GGCATCTCTGGACCCACCCAGGG + Intergenic
1014865234 6:126521173-126521195 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1015578793 6:134701605-134701627 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1016054729 6:139566796-139566818 GGCATTTCTGGACCTTCCCTGGG - Intergenic
1016061566 6:139636334-139636356 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1016127823 6:140427842-140427864 GGTACTTCTGGACCCACCCAGGG - Intergenic
1016127881 6:140428179-140428201 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1016135288 6:140532951-140532973 AGCACTTCTGGACCCATTCTGGG + Intergenic
1016151227 6:140745351-140745373 AACATTTCTGGACCTGCCCTGGG + Intergenic
1016251632 6:142049581-142049603 GGCACTTCTGAACCCACCCAGGG + Intergenic
1017924741 6:158901228-158901250 AGCATCTCTGGACATGCCCAGGG - Intronic
1018316581 6:162562428-162562450 GGCATTTCTGGACCTGCCCTGGG + Intronic
1018917600 6:168146325-168146347 AGCATTTCTGGACCTGTCCTGGG - Intergenic
1019044466 6:169132480-169132502 AGCATCTCTGGACATGCCCAGGG + Intergenic
1019611008 7:1936623-1936645 CGCACGGATGGACCTACCCACGG + Intronic
1020485304 7:8714039-8714061 TGCATTTCTGAACCCACCCAGGG - Intronic
1020573031 7:9890339-9890361 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1020573080 7:9890654-9890676 AGCACCTCTGGACCTGCCTGGGG + Intergenic
1020613128 7:10426234-10426256 GGCATTTCTGGACCTTCCCTGGG - Intergenic
1020624236 7:10558248-10558270 ACCATTTCTGGACCTGCCCTTGG + Intergenic
1021123757 7:16826497-16826519 AGAATTTCTGGACCTGCCCTGGG + Intronic
1021123807 7:16826808-16826830 GGCATCTCTGGACCTGCCCAGGG + Intronic
1021130930 7:16912757-16912779 GGCACTTCTGGACCCACCCAGGG - Intergenic
1021211859 7:17863548-17863570 AGCATTTCTAGACCCACCCTTGG + Intronic
1021382383 7:19983708-19983730 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1021641058 7:22736252-22736274 GGCACTTCTGGACCTACCCTGGG + Intergenic
1021884848 7:25128611-25128633 AGCATTTCTGGACATGCCCTGGG - Intergenic
1022348321 7:29539614-29539636 TGCACCTCAGGACCTGCCCAGGG + Intergenic
1022366959 7:29730614-29730636 GGCATTTCTGGACCTGCCCTCGG - Intergenic
1022732058 7:33036347-33036369 AGCCCTACTGGAGCCACCCACGG - Intronic
1023421760 7:39987858-39987880 AACACTTCTACACCTACCAAGGG + Exonic
1024170356 7:46778538-46778560 AGCATATCTGGACCTGGCCAGGG + Intergenic
1024410862 7:49039453-49039475 AGCAATTCTGGACCTGCCCTTGG + Intergenic
1024415083 7:49096821-49096843 GGCACTTCTGGACCCACCTGGGG + Intergenic
1024498389 7:50072393-50072415 AGCACTTCTGAACCCACCAAGGG + Intronic
1024662402 7:51510946-51510968 AGCATTTCTGGACCTTCCCTGGG - Intergenic
1025138001 7:56436719-56436741 GGCATTTCTGGACCTGCCCTAGG + Intergenic
1025232405 7:57211442-57211464 AGCACTCCTCGTCCTGCCCAAGG + Intergenic
1027808320 7:82859144-82859166 GGCACTTCTGGACCCACCTGGGG + Intronic
1027996131 7:85427338-85427360 AGCACTTCTAGACCTGACCTGGG + Intergenic
1028001386 7:85502195-85502217 AGAATTTCTGGACCTACCCAGGG + Intergenic
1028001439 7:85502499-85502521 AGCATCCCTGGACCTACCCCAGG + Intergenic
1028181514 7:87730313-87730335 AGCATTTCTGGGCCTGCCCTAGG + Intronic
1028186307 7:87789919-87789941 AGCATCTCTGGACCCACCCAGGG + Intronic
1028299483 7:89180257-89180279 AGCATTTCTAGACCAACCCTGGG - Intronic
1028339105 7:89695587-89695609 GGCACTTCTGAGCCCACCCAGGG + Intergenic
1028521844 7:91740954-91740976 GGCATTTCTGGACCTAACCTGGG - Intronic
1028521987 7:91742175-91742197 AGCATTTCTGGACCTGTCCTGGG - Intronic
1028950562 7:96630544-96630566 GGCATTTCTGGACCTGCCCTGGG - Intronic
1029825308 7:103186841-103186863 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1030370424 7:108693756-108693778 AGCACTTCTGGACCCACCCAGGG - Intergenic
1030408253 7:109142752-109142774 GGTACTTCTGGGCCCACCCAGGG - Intergenic
1030408304 7:109143064-109143086 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1030431584 7:109455462-109455484 AGCATTTCTGGGCCTCCCCTGGG - Intergenic
1030680298 7:112426925-112426947 GGCCTTTCTGGACCTAACCAAGG + Intronic
1030723577 7:112898528-112898550 GGCACTTCTAGACCCACCCTGGG + Intronic
1031231551 7:119114088-119114110 AGCACTTCTGGACCCAGCTAGGG - Intergenic
1031288352 7:119900750-119900772 GGCATTTCTGGACCTACACTGGG - Intergenic
1031306276 7:120131209-120131231 AGCATTTCTGGACCTGCCCTTGG + Intergenic
1031472443 7:122182825-122182847 AGCATTTCTGGACCTGCCTGGGG + Intergenic
1031546105 7:123053108-123053130 AGCATCTCTGGACCTGCCCTGGG - Intergenic
1031546152 7:123053419-123053441 GGCATTTCTGGACCTATCCTGGG - Intergenic
1032138715 7:129307206-129307228 AGCATCTCTGGACTTGCCCAGGG - Intronic
1032571275 7:133001580-133001602 AGCACTTTTGGAATTACACATGG + Intronic
1033128045 7:138721922-138721944 AGGACTTCTGCAGATACCCACGG - Exonic
1033489218 7:141825042-141825064 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1033691343 7:143740509-143740531 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1033719098 7:144037944-144037966 TGCACTTCTGAGCCTTCCCAGGG - Intergenic
1033833555 7:145282395-145282417 GGCACCTCTGGACCCATCCAGGG - Intergenic
1033882458 7:145902442-145902464 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1033887321 7:145964298-145964320 AGCATCTCTGGACCTACATAAGG + Intergenic
1034003373 7:147442110-147442132 AGCACATCTGAACCCACCCAGGG - Intronic
1035139116 7:156739058-156739080 AGCATTTCTAGACCTGCCCTGGG + Intronic
1035139162 7:156739335-156739357 AGCATCTCTGGACCTGCCCTGGG + Intronic
1035754030 8:2017809-2017831 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1036936269 8:13004977-13004999 AGCACCTCTAGACCTGCCCACGG + Intronic
1037295654 8:17397303-17397325 ATCATTTCTGGACCTGCCCTAGG + Intronic
1037295707 8:17397612-17397634 AACATCTCTGGACCTGCCCAGGG + Intronic
1037354128 8:17999063-17999085 AGCATTTCTGGACCTGCCCTGGG - Intronic
1039002267 8:32994961-32994983 AGCACTTCTGCACCTTTCCAGGG - Intergenic
1039640776 8:39218779-39218801 AGCACTTCTGGACCTGTCCTGGG - Intronic
1039663717 8:39496092-39496114 AGCATTTCTGGACCTGACCTAGG + Intergenic
1039836523 8:41260563-41260585 AGCACTTCTGGACCCAAGGAGGG + Intergenic
1040485764 8:47869764-47869786 AGGATTTCTGGACCTGCCCTGGG + Intronic
1041097729 8:54366146-54366168 AGCACTACTGGAATTACACAAGG - Intergenic
1041579889 8:59446786-59446808 AGCATTTCTGGACCTGCCCAGGG - Intergenic
1041606996 8:59793251-59793273 AGCATCACTGGACCTGCCCAGGG + Intergenic
1041827110 8:62108582-62108604 AGCACAACTGGACATACACATGG + Intergenic
1041869240 8:62614912-62614934 AGCATTTCTGGACCTGCCCTGGG - Intronic
1043042090 8:75276147-75276169 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1043134154 8:76500406-76500428 AACATTTCTGGACCTGCCCTGGG - Intergenic
1043213374 8:77552755-77552777 GGCACTTCTAGACCCACCCTAGG + Intergenic
1043340258 8:79229510-79229532 AGCATCTCTGGACCTGCCCTGGG - Intergenic
1043366871 8:79543106-79543128 AGCATTTCTGGACCTTCCCTAGG + Intergenic
1043384846 8:79738068-79738090 TGCATTTCTAGATCTACCCATGG + Intergenic
1043600348 8:81929505-81929527 AGCATTTCTGGACCTTCCCTGGG + Intergenic
1043627003 8:82273915-82273937 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1043760504 8:84062566-84062588 AGCACCTCTGGACATGCCCACGG - Intergenic
1043998028 8:86843276-86843298 GGCACTTCTGGACCTGCCCTGGG + Intergenic
1043998083 8:86843592-86843614 GGCACATCTGGACCTACCCAGGG + Intergenic
1044008690 8:86966089-86966111 GGCTCTTCTGGGCCCACCCATGG - Intronic
1044399134 8:91750072-91750094 GTCACTTCTGGTCCCACCCAGGG + Intergenic
1045041242 8:98226870-98226892 AGCATCTCTGGACCCACCCAGGG - Intronic
1045207164 8:100055045-100055067 GGCACCTCTGGACCCACCTAGGG + Intronic
1045592469 8:103613467-103613489 AGAATTTCTGGACCTGCCCTAGG - Intronic
1045994935 8:108351788-108351810 AGCATTTCTGGATCTGCCCTGGG + Intronic
1047138281 8:122106655-122106677 AGGATCTCTGGACCTTCCCAGGG - Intergenic
1047841191 8:128754923-128754945 AACATTTCTGGACCTTCCCCAGG + Intergenic
1047901173 8:129423597-129423619 AGCATCTCTGGACATGCCCAGGG + Intergenic
1047933654 8:129753729-129753751 AGCATTTCTGGACCTGCCCTGGG + Intronic
1047933705 8:129754039-129754061 AGCATCTCTGTACCCACCCAAGG + Intronic
1048027925 8:130603853-130603875 AGTCCTGCTGGACCAACCCAGGG + Intergenic
1048118795 8:131555662-131555684 GGCATTTCTGGACCTATCCTGGG + Intergenic
1049021749 8:139961761-139961783 GCCTCTTCTGGACCCACCCATGG + Intronic
1050121920 9:2316828-2316850 GGCACTTCTGGACCTACCCAGGG - Intergenic
1050248200 9:3713924-3713946 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1050807133 9:9694875-9694897 GGCATTTCTGGACCTGACCAAGG - Intronic
1050906843 9:11015745-11015767 ACCATTTCTAGACCTACCCAGGG - Intergenic
1050913966 9:11108154-11108176 AGCATTTTTGGACCTATCCCAGG + Intergenic
1050914018 9:11108463-11108485 AGCACATATGGACCCACCCAGGG + Intergenic
1051047221 9:12889130-12889152 AACATTTCTAGACCTACCCTTGG + Intergenic
1051306738 9:15718065-15718087 GGCATTTCTGGACCTGCCCTTGG + Intronic
1051465133 9:17368387-17368409 GGCATCTCTGGACCCACCCAGGG + Intronic
1051704391 9:19860975-19860997 GGCACCTCTGGACCCACCCAGGG + Intergenic
1051921778 9:22275149-22275171 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1052093989 9:24362481-24362503 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1052258726 9:26490697-26490719 AGCACTTCTGGACTTGCCCAGGG - Intergenic
1052420216 9:28234166-28234188 AGCATTTCTGGACCTGCCCTGGG + Intronic
1053040077 9:34862876-34862898 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1053749747 9:41240310-41240332 AGCACTTCTGGACCCAGCCAGGG - Intergenic
1054255249 9:62804650-62804672 AGCACTTCTGGACCCAGCCAGGG - Intergenic
1054336059 9:63810961-63810983 AGCACTTCTGGACCCAGCCAGGG + Intergenic
1054982606 9:71223635-71223657 AGCAATTCTGGACCTATCCTGGG + Intronic
1055181193 9:73388797-73388819 AGCATTCCTGGACCTGCCCTGGG - Intergenic
1055227422 9:74015749-74015771 AGCACCTCTGGACCCACCCCAGG + Intergenic
1055302121 9:74892576-74892598 AGCATCTCTGGACCCACCCAAGG + Intergenic
1055339184 9:75263399-75263421 AGAACTTCTGGGCCCACCTAGGG - Intergenic
1055339229 9:75263675-75263697 GGCATTTCTGGACCTAACCTGGG - Intergenic
1055579945 9:77698136-77698158 ATGATTTCTGGACCTGCCCAGGG - Intergenic
1055742790 9:79408085-79408107 AGCAAATCTGGGCCTACTCAGGG + Intergenic
1056007289 9:82285845-82285867 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1056211181 9:84366993-84367015 AGCACCTCTGGACCCACCAAAGG - Intergenic
1056230560 9:84538841-84538863 AGCACTTCTGAACCAGCCCTGGG - Intergenic
1056338850 9:85603715-85603737 AGCATTTCGGGACCTGCCCCAGG + Intronic
1056424619 9:86464574-86464596 AGCATCTCTGGACCCAGCCAGGG - Intergenic
1056957305 9:91092520-91092542 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1056957419 9:91093258-91093280 AGCACCTCTGGACCCACTCAGGG + Intergenic
1057288990 9:93788403-93788425 GGCATCTCTGGACCTGCCCAAGG - Intergenic
1058004020 9:99896186-99896208 AGCATTTTTGGACCTGCCCTGGG + Intergenic
1058183544 9:101826802-101826824 CTCTCTTCTGGATCTACCCAGGG - Intergenic
1058820967 9:108728886-108728908 GGCATCTCTGGACCTGCCCAGGG + Intergenic
1059041757 9:110822538-110822560 GGCATTTCAGGACCTACCCTGGG + Intergenic
1059094662 9:111399773-111399795 AGCACTTCTAGACCCACCCCAGG + Intronic
1059839104 9:118192092-118192114 AGCATTTCTGGACCCACTCTGGG + Intergenic
1059880321 9:118681811-118681833 TGCACTGATGGACCTAACCAAGG - Intergenic
1059887833 9:118767043-118767065 AGCACTTTTAAACCTACCTACGG + Intergenic
1060084096 9:120680939-120680961 AGCATTTCTGGACCTGCCCTTGG - Intronic
1060304512 9:122398634-122398656 AGCATTTCTGGACCTGACCTGGG + Intergenic
1203372330 Un_KI270442v1:320188-320210 GGCACTTCTGGACCCAGCCAGGG + Intergenic
1203375990 Un_KI270442v1:378375-378397 GGCACTTCTGGACCCAGCCAGGG + Intergenic
1186974712 X:14889268-14889290 AGCACATCTGAACTTACCCAAGG + Intronic
1187132793 X:16518515-16518537 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1187132844 X:16518834-16518856 GGCATCTCTGGACCCACCCAGGG + Intergenic
1187314891 X:18183900-18183922 GGCATCTCTGGACCTGCCCAAGG + Intronic
1187579304 X:20591621-20591643 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1187588465 X:20689883-20689905 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1187610569 X:20938956-20938978 GGCATTTCTGGACCTGCCCTTGG - Intergenic
1187612886 X:20961514-20961536 AGAATTTCTGGACCTGCCCTGGG + Intergenic
1187618123 X:21020592-21020614 AGCATTTCTGGACCTTCCCTGGG + Intergenic
1187618174 X:21020903-21020925 AGCATCTCTGGACCCACCCAGGG + Intergenic
1187651989 X:21419999-21420021 AGCACCTCTGGACCCACCCAGGG - Intronic
1187652045 X:21420311-21420333 GGCATTTCTGGACCTGCCCTGGG - Intronic
1187844938 X:23525288-23525310 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1188068862 X:25695157-25695179 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1188108238 X:26167729-26167751 AGCATTTCTAGACCTGCCCTTGG - Intergenic
1188116555 X:26251197-26251219 AGCATTTCTGGACTTGCCCTGGG + Intergenic
1188210695 X:27419846-27419868 AGTACCTCTGAACCTACCCAGGG + Intergenic
1188815250 X:34705239-34705261 GGCACTTCTGGACCCACCCGAGG - Intergenic
1188854226 X:35172104-35172126 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1188917841 X:35934473-35934495 GGCATTTCTGGACCTGCCCTGGG - Intronic
1188924553 X:36023561-36023583 AACACCTCTGGACCCACCCGGGG - Intergenic
1188930104 X:36098463-36098485 AGCACCTCTGGACCCACCTGGGG - Intronic
1188996115 X:36887935-36887957 AGCAATTCTGGACCTGTCCTGGG + Intergenic
1189013434 X:37070818-37070840 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1189411807 X:40779407-40779429 AGCATCTCTGGACCTGCCCAGGG - Intergenic
1189411866 X:40779718-40779740 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1189690549 X:43613036-43613058 AGCATTTCTGGACCTCCCTCAGG - Intergenic
1189858428 X:45247663-45247685 GGCATTTCTGGACCTGCCCTAGG - Intergenic
1189870046 X:45371801-45371823 AGCATTTCTGGAACTGCCCTGGG + Intergenic
1190015196 X:46820404-46820426 AGCACCTATGGACCTACCCAGGG + Intergenic
1190037884 X:47042742-47042764 AGTATCTCTGGACCCACCCAAGG + Intronic
1190046281 X:47113704-47113726 AACATTTCTGGACCTTCCCTGGG + Intergenic
1190374272 X:49774236-49774258 AGCATATCTGGACCCACCCAGGG - Intergenic
1190523030 X:51299276-51299298 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1190537746 X:51446528-51446550 AGCATTTCTGGACCTGCCCTTGG - Intergenic
1190614606 X:52217526-52217548 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1190804816 X:53825097-53825119 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1190899012 X:54650830-54650852 GGCACCTCTGGACCTGCCCTGGG + Intergenic
1191059265 X:56277757-56277779 GGCATCTCTGGACCTACCAAGGG - Intronic
1191059317 X:56278066-56278088 GGCATTTCTGGATCTGCCCAGGG - Intronic
1191179176 X:57540973-57540995 AGCACTTCTTGACCTACCATGGG + Intergenic
1191197173 X:57736913-57736935 AGAATTTCTGGACCTACCCTGGG + Intergenic
1191207228 X:57847956-57847978 AGCACTTCTGGACCCACACAGGG + Intergenic
1191207361 X:57849172-57849194 AGCACTTCTGAGCCCACACAGGG - Intergenic
1191650329 X:63529945-63529967 GGCACCTCTGGACCTACCCAAGG + Intergenic
1191700677 X:64038593-64038615 AGCATTTCTGGACCTGTCCTGGG + Intergenic
1191774853 X:64802453-64802475 GGCATTTCTGGACCTGCCCTAGG + Intergenic
1191949335 X:66571626-66571648 TGCACTTCTGGAACCACCCAGGG - Intergenic
1191949373 X:66571932-66571954 GGCATTTCTGGACCTACCCTGGG - Intergenic
1191974100 X:66851340-66851362 AGCATTTCTGGACCTGTCCTGGG - Intergenic
1191984028 X:66959426-66959448 AGCACCTCTGGACCCACCTGGGG - Intergenic
1191991207 X:67038862-67038884 AGAAATTCTGGACCTGCCCTGGG - Intergenic
1191994718 X:67080471-67080493 AGCACTTCTGGACCCACCTGGGG - Intergenic
1192060264 X:67817204-67817226 AGCATCCCTGGACCTGCCCAGGG + Intergenic
1192077943 X:68018932-68018954 AGCACCTCTGGACCCACCTGGGG + Intergenic
1192397308 X:70795062-70795084 GGCATTTCTGGACCTACCCTGGG + Intronic
1192406099 X:70887612-70887634 AGCATCTCTGGACCCACCCAGGG + Intronic
1192505624 X:71680434-71680456 AGGACTTTTGGACCTCCCCTGGG - Intergenic
1192640720 X:72859546-72859568 AGCATTTCTGGACCTGCTCTGGG + Intergenic
1192640991 X:72861230-72861252 AGCATTTCTGGACCTGCTCTGGG - Intergenic
1192714704 X:73627410-73627432 AGCACCTCTGGACCCATCCAAGG - Intronic
1192812630 X:74560497-74560519 GGCACTTCTGGACCCACCCGGGG + Intergenic
1192826706 X:74704634-74704656 AGCACTTCTGGACCTGATCTGGG - Intergenic
1192839164 X:74836203-74836225 GGCATTTCTGGACCTGCCCTGGG - Intronic
1192841205 X:74857741-74857763 GGCATTTCTGGACCTGCCCTGGG + Intronic
1192855901 X:75011599-75011621 AACACTTCTGGACCCACCTGGGG - Intergenic
1192855948 X:75011906-75011928 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1192858431 X:75039512-75039534 GGAATTTCTGGACCTAGCCAGGG - Intergenic
1192863834 X:75108238-75108260 AGCACCTCTGGACCCATGCAAGG + Intronic
1192890940 X:75389943-75389965 GGCATTTCTATACCTACCCAGGG + Intronic
1192908533 X:75578739-75578761 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1192937399 X:75874552-75874574 ACAACTTCAGGAACTACCCAAGG + Intergenic
1192995447 X:76507536-76507558 GGCATTTCTGGACCTATCCTGGG - Intergenic
1193000589 X:76558299-76558321 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1193088466 X:77468591-77468613 AGCACCTCTGGACCAACCCAGGG + Intergenic
1193161870 X:78237773-78237795 GGCATTTCTGGACCTGCCCAGGG - Intergenic
1193163480 X:78256421-78256443 GGCACTCCTGGACCCACCCAGGG - Intergenic
1193167858 X:78302325-78302347 AGCATTTCTGGACCTTCCCTGGG - Intronic
1193185030 X:78501837-78501859 GGCATTTCTGGACTTGCCCAGGG + Intergenic
1193194838 X:78619606-78619628 GGCATTTCTGGACCTACCCTGGG - Intergenic
1193210131 X:78797591-78797613 AGCATTTCTGGACCTAACCTGGG - Intergenic
1193220044 X:78913480-78913502 AGCATTTCTGGATCTGCCCTGGG - Intergenic
1193337366 X:80306671-80306693 AGCATTTCTGAACCTGCCCTGGG - Intergenic
1193344376 X:80388145-80388167 AGCATTTATGGACCTTCCCTGGG - Intronic
1193366232 X:80637317-80637339 AGCATTTCTGGAGCTTCCCTGGG - Intergenic
1193441063 X:81539537-81539559 GGCATTTCTGGATCTACCCTAGG + Intergenic
1193563327 X:83047263-83047285 AGCATCTCTGGACCCACCTAGGG - Intergenic
1193580522 X:83258299-83258321 AGCATTTCTAGACCTGCCCTTGG + Intergenic
1193658260 X:84224722-84224744 AACATTTCTAGACCTACCCTGGG - Intergenic
1193665431 X:84310210-84310232 AGCATTTCTGGACTTGCCCTGGG + Intergenic
1193802470 X:85952796-85952818 AGCCTTTCTGGACCTACCCTCGG + Intronic
1193856577 X:86610826-86610848 AGCATTTCTGGACCTGCCCTGGG - Intronic
1193877908 X:86884688-86884710 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1193880086 X:86910954-86910976 ATCATCTCTGGACCCACCCAGGG - Intergenic
1193907639 X:87262103-87262125 AGCACTTCTTGACCCACCTGGGG + Intergenic
1193915543 X:87357852-87357874 AGAACTTTTGGACCTGCCCAGGG + Intergenic
1193930331 X:87544363-87544385 AGTACTCCTGGACCCACCTAGGG + Intronic
1194023603 X:88724104-88724126 AGCACCTCTGGACCCACCCACGG + Intergenic
1194037015 X:88887219-88887241 GGCATCTCTGGACCTACTCAGGG - Intergenic
1194219557 X:91174818-91174840 AGCATATCTGGACATGCCCAGGG - Intergenic
1194219594 X:91175045-91175067 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1194229659 X:91306655-91306677 GATACTTCAGGACCTACCCAGGG - Intergenic
1194229699 X:91306964-91306986 GGCATTTCTGAACCTACCCTGGG - Intergenic
1194323175 X:92477515-92477537 AGCATTTCTGGACCTGCCCTGGG - Intronic
1194340589 X:92700548-92700570 AGCATCTCTGGACCTGCCCAGGG - Intergenic
1194370842 X:93069707-93069729 GGCATTTCTGGACCTGCCCTAGG + Intergenic
1194389043 X:93293339-93293361 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1194396642 X:93394830-93394852 GGCTCCTCTGGACCCACCCACGG - Intergenic
1194415508 X:93606629-93606651 AGCATTTCTGGACCTGCCTTGGG + Intergenic
1194447103 X:94001941-94001963 AGCATCTCTGGACATGCCCAGGG - Intergenic
1194476951 X:94369886-94369908 AGCACCTCTGAACCTACCCAGGG + Intergenic
1194522070 X:94931484-94931506 AGCATTTCTGGACCTGCCGTGGG - Intergenic
1194530740 X:95045433-95045455 TCCACTTCTGGACCTGCCCTGGG + Intergenic
1194532530 X:95069138-95069160 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1194574587 X:95596490-95596512 GGCATTTCTGGACCTCCCCTGGG + Intergenic
1194595221 X:95848681-95848703 AGCACTTCTGGACCCACCCAGGG + Intergenic
1194783834 X:98057842-98057864 GGCATTTCTGGACATACCCTGGG - Intergenic
1194787608 X:98106191-98106213 GGCATTTCTGGACCTGCCCAGGG - Intergenic
1194795901 X:98210810-98210832 AGCATTTCTGGACTTGCCCTGGG + Intergenic
1194831821 X:98632425-98632447 AGCATTTCTGGACCTGCCCTGGG + Intergenic
1194841906 X:98753614-98753636 AGCATCTCTGGACATGCCCAGGG - Intergenic
1194857796 X:98956052-98956074 GGCACTTCTGGACCCATCCGAGG - Intergenic
1194892259 X:99394667-99394689 AGCATTTCTGGACCTTCCCTGGG - Intergenic
1194892474 X:99397743-99397765 AGCATCTCTGGACCCACCCAAGG - Intergenic
1194928831 X:99862262-99862284 GGCATTTCTGGACCTGCCCTTGG + Intergenic
1194990733 X:100544037-100544059 AGCAATTTTGGACCTGCCCTAGG + Intergenic
1195090098 X:101450482-101450504 AGCATTTCTAGACCTGCCCTGGG - Intronic
1195115776 X:101696587-101696609 ACCATTTCTGGACCTGCCCTGGG + Intergenic
1195132179 X:101863996-101864018 GGCACCTCTGGACCCACCCAAGG + Intergenic
1195172197 X:102280798-102280820 GGCACTTCTGGACCCACCTGGGG - Intergenic
1195186663 X:102406295-102406317 GGCACTTCTGGACCCACCTGGGG + Intronic
1195199379 X:102533018-102533040 AGCATTTCTGAACTTACCCTGGG + Intergenic
1195312301 X:103643492-103643514 AGCATTTATGGACCTGCCCTGGG + Intergenic
1195601353 X:106752096-106752118 AGCATTTCTAGACCCACCCTGGG + Intronic
1195984540 X:110614877-110614899 AGCATTTCTGGACCTGCTCTGGG - Intergenic
1196215877 X:113050924-113050946 AACATTTCTGGACCTGCCCTGGG + Intergenic
1196226292 X:113171154-113171176 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1196242968 X:113365548-113365570 AGCATCTCTGGACACACCCAGGG - Intergenic
1196247411 X:113415829-113415851 AGCATTTCTGGACCTTCCCTGGG + Intergenic
1196247459 X:113416143-113416165 AGCACCTCTGGACATGCCCAGGG + Intergenic
1196399530 X:115299704-115299726 AACACTTCTGGAACTGCCCTAGG - Intronic
1196467875 X:115991621-115991643 ATCACCTCTGGACCCACCTAGGG + Intergenic
1196494332 X:116306838-116306860 GGCATTTCTGGACCTTCCCTGGG - Intergenic
1196538894 X:116882275-116882297 GGCACTTCTACACCAACCCAGGG - Intergenic
1196564560 X:117189535-117189557 AGCACCTCTGGACCTGCCCAGGG + Intergenic
1196576643 X:117325929-117325951 AGCAATTCTGGACCTGCCCTCGG - Intergenic
1196590892 X:117484409-117484431 GGTACTTCTGGACCTAACCAGGG + Intergenic
1196591041 X:117485379-117485401 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1196625408 X:117871862-117871884 AGCATCTCTGGACCCACCCAGGG + Intergenic
1196865373 X:120066198-120066220 AGCATTTCTGGACCTGCCCCAGG + Intergenic
1196877720 X:120170082-120170104 AGCATTTCTGGACCTGCCCCAGG - Intergenic
1196962095 X:121014495-121014517 GGCATTTCTGGACCTTCCCTAGG - Intergenic
1196984471 X:121253405-121253427 AGCACTTTTGGACTCATCCAGGG - Intergenic
1196984522 X:121253715-121253737 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1197016012 X:121626973-121626995 AGCATTTCTGGTCCTGCCCTGGG + Intergenic
1197016065 X:121627273-121627295 AGAATCTCTGGACCCACCCAAGG + Intergenic
1197068619 X:122266480-122266502 GACACTTCTAGACCCACCCAGGG - Intergenic
1197068661 X:122266796-122266818 AGCATTTCTGGATCTGCCCTGGG - Intergenic
1197112998 X:122798162-122798184 AGCACCTCTGGACCCACCTGGGG + Intergenic
1197178099 X:123505668-123505690 GGCATTTCTGGACCTGCCCTAGG + Intergenic
1197307692 X:124863349-124863371 AGCATTTCTGGACCTGCCCTGGG + Intronic
1197363145 X:125532332-125532354 AGCACTTCTGGACCCACCCGAGG - Intergenic
1197411498 X:126121305-126121327 AGCATTTCTGGATCTGCCCCGGG - Intergenic
1197435631 X:126425067-126425089 AGCAATTCTGGACCTGCCCTGGG - Intergenic
1197470064 X:126856157-126856179 AGCACCTCTGCACCCACACAGGG + Intergenic
1197481811 X:126995684-126995706 AATATTTCTGGACCTTCCCAGGG + Intergenic
1197492019 X:127129247-127129269 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1197492068 X:127129539-127129561 AGCATTTCTGGACCTACCAGGGG + Intergenic
1197524458 X:127545070-127545092 AACACTTCTGAACCTACCCTGGG - Intergenic
1197661512 X:129178845-129178867 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1197953216 X:131919570-131919592 AGCATCTTTGGACCTGCCCAGGG + Intergenic
1197987132 X:132278548-132278570 AGCATTTCTGGACTTGCCCTTGG - Intergenic
1198293040 X:135257248-135257270 AGCATTTCTGGACCCGCCCTGGG + Intronic
1198430733 X:136564324-136564346 GGCACCTCTGGACCTGCCAAGGG - Intergenic
1198537587 X:137601563-137601585 AGCATTTGTGGACCTTCCCTGGG + Intergenic
1198578590 X:138037578-138037600 GGTACCTCTGGACCTGCCCATGG + Intergenic
1198664454 X:139004960-139004982 AGCACCTCTGGACCTGACCAGGG + Intronic
1198694887 X:139325181-139325203 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1198785446 X:140283257-140283279 GGCATTTCTGGACCTGCCCTGGG - Intergenic
1198788203 X:140313969-140313991 AGCATTTCTGGACCTGCCGTGGG + Intergenic
1198788253 X:140314273-140314295 AGCACCTCTGGACCCACCCAGGG + Intergenic
1198817999 X:140613957-140613979 GGCACTTTTGGACCCACCCAGGG - Intergenic
1198925527 X:141787914-141787936 AGCACTTCTGGACCCACCCAGGG - Intergenic
1198927388 X:141814460-141814482 AGCACCTCTGGACCTACCCAGGG - Intergenic
1198995157 X:142566336-142566358 AACATCTCTGGACCTGCCCAGGG - Intergenic
1198996207 X:142577153-142577175 GCCATTTCTGGACCTACCCTGGG - Intergenic
1199050603 X:143232505-143232527 AGCATTTCTGGACCTGCCCTAGG + Intergenic
1199135402 X:144244172-144244194 AGCATTTCTAGACCTGCCCTGGG + Intergenic
1199138875 X:144287062-144287084 AGCATTTCTGGACCTACCCTGGG - Intergenic
1199148313 X:144397587-144397609 AGCACTTCTGGTCCTGCACTGGG + Intergenic
1199162430 X:144628806-144628828 GTAACTTCTGGACCCACCCAAGG + Intergenic
1199163897 X:144647641-144647663 GGCATTTCTGGACCTTCCCCTGG - Intergenic
1199191842 X:144980379-144980401 AGCATTTCTGGACCTGCTCTTGG + Intergenic
1199210747 X:145206788-145206810 GGCCTTTCTGGACCTACCCTGGG + Intergenic
1199216240 X:145263089-145263111 AGCTTTTCTGGATCTACCCTGGG + Intergenic
1199217859 X:145281916-145281938 GGTACCTCTGGACCCACCCAGGG - Intergenic
1199258565 X:145744854-145744876 AGCACTTTTGGACCCGCCCTGGG + Intergenic
1199277699 X:145965114-145965136 AGCATCTCTGGACCTGCCCAGGG + Intergenic
1199358332 X:146886831-146886853 AGTATTTCTGGACCTACCCTGGG + Intergenic
1199374174 X:147087991-147088013 TGCACTTCTGGATCCACCCAGGG - Intergenic
1199393700 X:147309788-147309810 AGCATTTCTGCACCTGCCCTGGG + Intergenic
1199441047 X:147867747-147867769 AGCACCTCTGGAACCACTCAGGG + Intergenic
1199455175 X:148020311-148020333 GGCATTTCTGGACCTGCCCTGGG - Intronic
1199908473 X:152259970-152259992 AGCATTTCTGGACCTGCCTTGGG + Intronic
1200315885 X:155132820-155132842 AGCATTTCTGGACCTGCTCTGGG + Intronic
1200369965 X:155714990-155715012 AGCATTTCTGGACCTGCTCTGGG - Intergenic
1200370550 X:155720027-155720049 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1200379500 X:155819925-155819947 AGCATTTCTAGACCCACCCTGGG + Intergenic
1200427252 Y:3035037-3035059 AGCATTTCTGGACCTGCCCTGGG - Intergenic
1200556069 Y:4638582-4638604 AGCATATCTGGACATGCCCAGGG - Intergenic
1200556105 Y:4638809-4638831 AGCATTTCTGGACCTGCTCTGGG - Intergenic
1200605982 Y:5263883-5263905 AGCATCTCTGGACCTGCACAGGG - Intronic
1200631272 Y:5590672-5590694 AGCATTTCTGGACCTGCCCTGGG - Intronic
1200648943 Y:5817286-5817308 AGCATCTCTGGACCTGCCCAGGG - Intergenic
1200678638 Y:6181598-6181620 GGCATTTCTGGACCTGCCCTGGG + Intergenic
1201066040 Y:10095207-10095229 GGCACTTCTGGACCCAGCCAGGG - Intergenic
1201405201 Y:13642969-13642991 AGCACTTCTGGACCTACCCAGGG + Intergenic
1201762489 Y:17555326-17555348 GGCACTTCTGGACCCAGCCAGGG + Intergenic
1201839063 Y:18350662-18350684 GGCACTTCTGGACCCAGCCAGGG - Intergenic
1202037589 Y:20650151-20650173 AGCACCTGTGGACGTACCCTTGG - Intergenic