ID: 989437684

View in Genome Browser
Species Human (GRCh38)
Location 5:41433955-41433977
Sequence TGTGACGTAATATCACCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989437682_989437684 19 Left 989437682 5:41433913-41433935 CCTACAGGTGGGAAGGGAAAAAG 0: 1
1: 0
2: 2
3: 32
4: 362
Right 989437684 5:41433955-41433977 TGTGACGTAATATCACCTGATGG 0: 1
1: 0
2: 0
3: 4
4: 112
989437679_989437684 29 Left 989437679 5:41433903-41433925 CCATCAAAAGCCTACAGGTGGGA 0: 1
1: 0
2: 0
3: 10
4: 136
Right 989437684 5:41433955-41433977 TGTGACGTAATATCACCTGATGG 0: 1
1: 0
2: 0
3: 4
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989437684 Original CRISPR TGTGACGTAATATCACCTGA TGG Intronic
902269732 1:15294800-15294822 TGTTACCAAATGTCACCTGAGGG + Intronic
904190474 1:28739073-28739095 TCTAATGTAAAATCACCTGAAGG + Intronic
909547404 1:76863089-76863111 TGTGAAGGAATCCCACCTGAAGG - Intergenic
911824895 1:102470234-102470256 TGTGAAGTAATATCTCATTATGG - Intergenic
916325437 1:163553844-163553866 TGTGAAGTGTTATCACCTGAAGG - Intergenic
919054818 1:192556890-192556912 AGTGATATAATATCACTTGAAGG + Intergenic
919953064 1:202383990-202384012 TGTGAAGTAATATCACTTTGTGG - Intronic
923252007 1:232186237-232186259 GGTGACGTGATATCACCTTTGGG + Intergenic
923768663 1:236917360-236917382 AGTGATGTAATATCACTTGAAGG + Intergenic
924620079 1:245652878-245652900 TGTGGCGTAATGGCACATGATGG + Intronic
1062895709 10:1101635-1101657 TGTGATGCAAAATCACCAGACGG - Intronic
1063298740 10:4832789-4832811 TGTGACATAAGCTAACCTGAAGG - Intronic
1065473158 10:26103892-26103914 TGTGAAGTGGTATCACATGAGGG + Intronic
1066139872 10:32493745-32493767 TGTGAGGTAATATTACATGGTGG + Intronic
1066601642 10:37114490-37114512 AGTGATGTAATATCATTTGAAGG - Intergenic
1068237884 10:54262642-54262664 TGTGACCTAATCTCAAGTGAAGG + Intronic
1071114658 10:82203721-82203743 TGTGATGTAATTTCCCATGAAGG - Intronic
1073661870 10:105484938-105484960 TATGAAGCAAAATCACCTGATGG - Intergenic
1080162718 11:29197580-29197602 TGTGATATAGTATCTCCTGATGG + Intergenic
1082041298 11:47687316-47687338 TTTGACTTAATATCAACAGAGGG + Intronic
1083539548 11:63503000-63503022 TCTGACATAACATCACATGACGG + Intergenic
1083566439 11:63721651-63721673 TCTCACCTAATATCACCTTAGGG - Intronic
1088498406 11:110456387-110456409 TGTGAAATAATATAACGTGAGGG + Intronic
1095495013 12:42775257-42775279 TGTCACGGAATGTCTCCTGAAGG - Intergenic
1098152784 12:67565019-67565041 TGTGAAATCATATCACATGAGGG - Intergenic
1100085927 12:90910727-90910749 TGTAATGTGATATCACCTTATGG - Intronic
1100503046 12:95192933-95192955 TGTGCAGTAATATCACATTATGG - Intronic
1103454631 12:121055288-121055310 TGTGACGTATCATCACATGCAGG + Intergenic
1109861303 13:68202070-68202092 TGTGAGGTGATATCACATTATGG + Intergenic
1111025351 13:82513865-82513887 TGTGAGGTGATATCTCCTTATGG - Intergenic
1112107399 13:96256175-96256197 AGTGACCATATATCACCTGATGG - Intronic
1114359981 14:21960804-21960826 TGTGACATAATACCACTTCATGG - Intergenic
1115917751 14:38335866-38335888 TGTGAGGTAATATCTCATCATGG + Intergenic
1119866358 14:77978414-77978436 TGTGACCTATTACCTCCTGAAGG + Intergenic
1121493348 14:94375662-94375684 TGTGCCCTAACATCAGCTGAAGG - Intergenic
1126751389 15:51881011-51881033 TGTGAAGTAATATCACATTGTGG + Intronic
1126905260 15:53358299-53358321 TGTTTCTTTATATCACCTGAAGG + Intergenic
1129099556 15:73247009-73247031 TGTGATGTGTTATCACCTTAAGG + Intronic
1133551276 16:6856564-6856586 AGGGACAGAATATCACCTGATGG - Intronic
1136717423 16:32293311-32293333 AGTGATGTAATATCATTTGAAGG - Intergenic
1136835797 16:33499574-33499596 AGTGATGTAATATCATTTGAAGG - Intergenic
1141733450 16:85837261-85837283 TGTGACGCAAGCTCACCTGGAGG + Intergenic
1203009006 16_KI270728v1_random:224463-224485 AGTGATGTAATATCATTTGAAGG + Intergenic
1203145976 16_KI270728v1_random:1799909-1799931 AGTGATGTAATATCATTTGAAGG - Intergenic
1146697656 17:34922272-34922294 TGTGAAATTATACCACCTGAGGG + Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1152779779 17:82221702-82221724 TGTGAAGTAGTATCTCATGATGG - Intergenic
1153580935 18:6572590-6572612 TAGGTGGTAATATCACCTGAAGG + Intronic
1154474246 18:14739176-14739198 AGTGATGTAATATCATTTGAAGG - Intronic
1155104800 18:22652623-22652645 AGTGGTGTAATATCACTTGAAGG - Intergenic
1155662869 18:28272716-28272738 TGTGAAGTGATATCTCCTTATGG - Intergenic
1160241527 18:77127816-77127838 TGTGTAGTGATATCTCCTGATGG - Intronic
1162351691 19:10154276-10154298 TGTGAGGTAACCTCACCTGTGGG - Exonic
1164294656 19:23899238-23899260 TATGACACAATGTCACCTGAAGG - Intergenic
928615366 2:33033280-33033302 TCTGACTTAATATCAACAGAGGG - Intronic
929401010 2:41581729-41581751 TGTGATCTAATATCACCTACAGG - Intergenic
932473060 2:71976380-71976402 TGTGAAGTGATATCACCTCGTGG - Intergenic
933062178 2:77751872-77751894 AGTGATGTAATATCACTTGAAGG - Intergenic
936801679 2:116276328-116276350 TGTGAGGTAGTATCTCCTGGTGG + Intergenic
944998691 2:205324147-205324169 TGTGACGTAGCAACACCTAATGG - Intronic
1171782870 20:29437141-29437163 TGTGTCACAATACCACCTGAGGG + Intergenic
1174664640 20:52246596-52246618 TGTGATGAAAAATCACCTAATGG - Intergenic
1177432753 21:21011922-21011944 TGTGAGGTGATATCTCCTTATGG - Intronic
1179378907 21:40880289-40880311 TCTGATGTTATATGACCTGAAGG - Intergenic
952124522 3:30284856-30284878 TGTGACTTCATCTCTCCTGAGGG + Intergenic
953870610 3:46624095-46624117 AGTGATAAAATATCACCTGAAGG - Intronic
957232808 3:77542190-77542212 TGTGAAGGGATATCAGCTGAAGG - Intronic
960347120 3:116546858-116546880 TGTGAGGTGATATCACATTATGG - Intronic
962715148 3:138119193-138119215 TTTGACCTAAAATCACCTCAGGG - Intergenic
964417044 3:156458434-156458456 TGTGAGGTATAATCACCTGCAGG + Intronic
965059210 3:163761905-163761927 TGTGAAGTAATTTCTCATGATGG + Intergenic
966719200 3:183044700-183044722 TGTGACACAATCTCACCTGCTGG + Intronic
971921765 4:32949650-32949672 TGTGACCAAATACCACCTGTGGG + Intergenic
971978119 4:33717352-33717374 TGTGAAGTAATATCTCATCATGG + Intergenic
972188472 4:36561764-36561786 TGTGAGATAATATCTCCTGGTGG - Intergenic
976323274 4:83740961-83740983 TGTGGTATAATATCACATGAAGG - Intergenic
979092322 4:116500595-116500617 TGTGCCTTAATATCACATTAAGG - Intergenic
979694288 4:123594340-123594362 TTTGACGTAATTATACCTGAAGG - Intergenic
984248213 4:177300864-177300886 TGTGACCAAATGTCACCTGAGGG + Intergenic
984655643 4:182315009-182315031 AGTGACCTAATATCACGTCAAGG - Intronic
988624388 5:32856824-32856846 TGTGAGGTAATATCTCATTATGG + Intergenic
989437684 5:41433955-41433977 TGTGACGTAATATCACCTGATGG + Intronic
991310408 5:65234544-65234566 TGTGAGGTAATATCTCATGGTGG - Intronic
996858088 5:128032218-128032240 TGTGAGGTAGTATCTCCTTATGG - Intergenic
1000625999 5:163539378-163539400 TGTGAGGTGATATCTCATGATGG + Intergenic
1001860534 5:175050526-175050548 TCTGACCTAACATCCCCTGATGG + Intergenic
1011417106 6:87133391-87133413 GGTGACTCAACATCACCTGAGGG - Intergenic
1016112858 6:140247529-140247551 ATTGACGTTATATCACTTGAAGG - Intergenic
1019615793 7:1960088-1960110 GAAGACGTAATATCACTTGAAGG + Intronic
1022609413 7:31854212-31854234 TGCTATCTAATATCACCTGAGGG - Intronic
1027533327 7:79364031-79364053 TGTGAGGTGATATCTCATGATGG - Intronic
1030437481 7:109542042-109542064 GGTGATGAAATATCACCTGTAGG + Intergenic
1030717514 7:112827471-112827493 AGTGGTGTAATATCACTTGAAGG - Intronic
1032140457 7:129324906-129324928 AGTGCTGTAATATCACATGAAGG - Intronic
1039196907 8:35042596-35042618 TGTGACTTAATATCACAGAAGGG + Intergenic
1040966838 8:53090797-53090819 AGTGAGGTAGTATCACATGATGG + Intergenic
1041146940 8:54886491-54886513 TGTGAGGTGATATCTCCTGGTGG - Intergenic
1042113616 8:65408050-65408072 TGTTCCGCAATATCTCCTGAAGG - Intergenic
1046735522 8:117772531-117772553 TGTGACGTATTTTCACCATATGG + Intergenic
1048815070 8:138325286-138325308 TGTGAAGTTAAAGCACCTGAAGG - Intronic
1053168275 9:35859935-35859957 TGTGACGGAATACGTCCTGATGG - Intergenic
1053619003 9:39797474-39797496 TGTGATCTACTGTCACCTGAAGG - Intergenic
1053877169 9:42556823-42556845 TGTGATCTACTGTCACCTGAAGG - Intergenic
1053895499 9:42737871-42737893 TGTGATCTACTGTCACCTGAAGG + Intergenic
1054234526 9:62544899-62544921 TGTGATCTACTGTCACCTGAAGG + Intergenic
1054265153 9:62909955-62909977 TGTGATCTACTGTCACCTGAAGG + Intergenic
1056485139 9:87048965-87048987 TGTGAAGTAATATCTCATTATGG - Intergenic
1191968221 X:66784790-66784812 TGTGAGGTAATATCACATAGTGG - Intergenic
1192708676 X:73556591-73556613 TCTGATGTAACATCACATGACGG - Intergenic
1192716272 X:73645611-73645633 TGTGAGGTAATATCTCATTATGG + Intronic
1197971266 X:132117689-132117711 TGTGATGTAATAACACCTTTTGG + Intronic
1200076010 X:153551268-153551290 TGTGAGGCAATATCTCCTGGTGG + Intronic
1200889840 Y:8311773-8311795 TATGACATAATTTCACCTGTGGG - Intergenic
1202245028 Y:22811315-22811337 TATGACACAATATCACCTGTGGG - Intergenic
1202398018 Y:24445061-24445083 TATGACACAATATCACCTGTGGG - Intergenic
1202472763 Y:25225026-25225048 TATGACACAATATCACCTGTGGG + Intergenic
1202581588 Y:26387276-26387298 TGTGAAGTAATATCACTTTGTGG + Intergenic