ID: 989444418

View in Genome Browser
Species Human (GRCh38)
Location 5:41510698-41510720
Sequence GCGGAGGCACTAAGGGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989444418_989444421 -10 Left 989444418 5:41510698-41510720 CCGTGCTCCCTTAGTGCCTCCGC 0: 1
1: 0
2: 0
3: 10
4: 136
Right 989444421 5:41510711-41510733 GTGCCTCCGCCAGACTCCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989444418 Original CRISPR GCGGAGGCACTAAGGGAGCA CGG (reversed) Intergenic
902663253 1:17920158-17920180 GCGGAGACACTCAGGGTTCAAGG - Intergenic
903066314 1:20701647-20701669 GGGGAGGCAGGAAGGGAGCCAGG + Intronic
904848773 1:33441155-33441177 GCGGAGGCACCAAGGAAACATGG + Intergenic
905389869 1:37629550-37629572 GCGGAGTGAGTAATGGAGCATGG - Exonic
912190036 1:107327267-107327289 GGGGAGGGACTAAAGAAGCAAGG + Intronic
915941812 1:160123199-160123221 GGTGAGGCCCTGAGGGAGCAAGG - Exonic
920617006 1:207503459-207503481 GTGGAGGCTCCAGGGGAGCAGGG + Intronic
922272432 1:224045842-224045864 GCGGTGGCATTAACAGAGCAGGG - Intergenic
922464596 1:225838542-225838564 GCGGGGGCACTAAGGGTGGCAGG + Intronic
922723228 1:227909646-227909668 GGGGAGGGAGTAAGGGAGGAAGG + Intergenic
1062789264 10:291091-291113 GCCCAGCCACTAAGGGGGCATGG + Intronic
1067736083 10:48851891-48851913 GAGGAGGCACTGGGAGAGCAGGG + Intronic
1068092917 10:52454996-52455018 GAGGGGGCACAGAGGGAGCAAGG - Intergenic
1071519296 10:86319150-86319172 GGGGAGGCACCCAGGGAGAAAGG + Intronic
1076922615 10:133462658-133462680 CTGAAGGCACTAAGGGAGCCCGG - Intergenic
1081887125 11:46507532-46507554 GAGGATGCGCTAAAGGAGCAGGG - Intronic
1083750327 11:64757535-64757557 GGGGAGACACTGGGGGAGCAGGG + Intronic
1086380074 11:86243791-86243813 GAGGAGGCAGGAAGGGAGAAAGG - Intergenic
1090408617 11:126492508-126492530 GCCGAGGGGCTAGGGGAGCATGG + Intronic
1091228803 11:133974524-133974546 ACAGAGGCACTGAGGGAGGAGGG - Intergenic
1094298592 12:28935778-28935800 GCGGGGGCATCTAGGGAGCAAGG - Intergenic
1098430968 12:70419797-70419819 AAGGAGGCACTTAGGGAGGATGG + Intronic
1105344231 13:19559569-19559591 GAGGAGGAGCAAAGGGAGCATGG + Intergenic
1105535800 13:21262005-21262027 GAGGAGGAGCAAAGGGAGCATGG - Intergenic
1107905386 13:45056708-45056730 GCAGAGGGACAAAGGGAGCCTGG + Intergenic
1108083481 13:46761222-46761244 GGGCAGGCGCTAAGGTAGCAGGG - Intergenic
1109656695 13:65400408-65400430 GCTTAAGGACTAAGGGAGCAAGG + Intergenic
1110010191 13:70323260-70323282 GCAAAGGCAGTAAGGGAGAAGGG - Intergenic
1113663090 13:112120275-112120297 GGGGAGGAACGAAGGGAGCGGGG + Intergenic
1114216881 14:20663794-20663816 GCGGAGGCACATCGGGAGAAGGG - Intergenic
1114421110 14:22583715-22583737 GCGGAGTCCCTGAGTGAGCAAGG + Intronic
1118494163 14:66291677-66291699 GTGTATGCACTTAGGGAGCATGG - Intergenic
1118994052 14:70821595-70821617 GCAGAGCCACTAAGCAAGCAGGG + Intergenic
1119754398 14:77104617-77104639 GTGAAGGCCCTAAGGGAGCAAGG - Intronic
1122409348 14:101518042-101518064 GTGGAGGCACCAAGAGGGCAGGG + Intergenic
1122824816 14:104364458-104364480 GCGTGGGCTCTGAGGGAGCAGGG + Intergenic
1127324851 15:57884902-57884924 GCGGAGTTACTTAGTGAGCAGGG - Intergenic
1129576110 15:76747704-76747726 GAGGAGGCAGTAAGAGAGGAGGG - Intronic
1130669134 15:85894927-85894949 TCAGAGGCAGTGAGGGAGCAGGG + Intergenic
1130893851 15:88155381-88155403 CTGGAGGCTCTAAGGGAGAATGG - Intronic
1133088520 16:3384800-3384822 GCGGAAGGACTCTGGGAGCAGGG - Exonic
1135792053 16:25405857-25405879 GAGGAGGCAGAAAGGGAGCCAGG + Intergenic
1138680777 16:58682276-58682298 GGGCAGGAACTAAGGGGGCAGGG + Intronic
1140897875 16:79341029-79341051 GCAGAGGGACAAAGGGACCAAGG + Intergenic
1140953916 16:79845024-79845046 GGGGAGGCCAAAAGGGAGCAGGG + Intergenic
1141707867 16:85678658-85678680 TCTGAAGCACTAAAGGAGCAAGG + Exonic
1143161787 17:4876714-4876736 GCGGAGGCAGAAAGTGAGGATGG - Intronic
1144390472 17:14788963-14788985 GCAGAGGCCAGAAGGGAGCAGGG - Intergenic
1144679625 17:17184330-17184352 GCGGAGGCACTGTAGGAGCGAGG + Intronic
1146486320 17:33245846-33245868 GAGGAAGCACTAATGGAGGAAGG + Intronic
1147322981 17:39657115-39657137 CCGGAGGCAGAGAGGGAGCAGGG + Intronic
1148557961 17:48589850-48589872 CCGCTGGCACTGAGGGAGCATGG + Intronic
1149035103 17:52125187-52125209 GCGGAAGCACTCAGGCAGCAAGG - Intronic
1149651662 17:58279790-58279812 GAGGAGTCACTAGTGGAGCAGGG + Intronic
1150135063 17:62690918-62690940 AAGAAGGCACTGAGGGAGCAGGG - Intronic
1150353846 17:64466641-64466663 GAGGTGGCACCAAGAGAGCAAGG + Exonic
1150790489 17:68197791-68197813 GCTGAGGGACTGAAGGAGCAGGG - Intergenic
1151050979 17:70978487-70978509 GTGGAGGGAGGAAGGGAGCAAGG + Intergenic
1151387229 17:73762467-73762489 GCTGAGGTCCCAAGGGAGCAAGG + Intergenic
1152002500 17:77655450-77655472 CCGGGGGCTCTCAGGGAGCACGG - Intergenic
1153375535 18:4373016-4373038 GCTGAGGCACTGGGGGTGCACGG + Intronic
1154121811 18:11658317-11658339 GCGGAGGGACAAAGGGATCAAGG - Intergenic
1156457093 18:37300945-37300967 AGGCAGGCACTAAGGCAGCAGGG + Intronic
1157429788 18:47615266-47615288 CCTGAGGCACAGAGGGAGCAAGG + Intergenic
1161390679 19:4018885-4018907 GCGGAGGCCCTGATGCAGCATGG + Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1166997371 19:46726113-46726135 GCAGAGGCCCTGAGGCAGCAAGG + Intronic
1167526850 19:49989519-49989541 GGAGAGGCACTAAGGGCGCCAGG - Intronic
927092580 2:19723299-19723321 GGAGAGGCACTGAGGGAGCACGG - Intergenic
932466146 2:71925602-71925624 GCTGAGGCATTCAGGCAGCAGGG + Intergenic
932796658 2:74701573-74701595 GGGGAGGGACTCACGGAGCATGG - Intergenic
936027781 2:109046762-109046784 GAGGAGGCAGGAAGGGACCAAGG - Intergenic
939563531 2:143759574-143759596 GCGGAGGGACTTAGGGGTCATGG - Intronic
939643608 2:144669916-144669938 GCTGAGGCACTCAGGGCGCCTGG - Intergenic
940368907 2:152878521-152878543 GCGAAGGGAATAAGAGAGCAGGG - Intergenic
946254146 2:218430890-218430912 GCGGGGGCAGTGAGGGAGCCAGG + Intronic
947464453 2:230329169-230329191 GCTGAGGCACTCTGTGAGCACGG + Intronic
1169566667 20:6861372-6861394 GAGGAGGCACTACTGGATCAAGG + Intergenic
1175290503 20:57871988-57872010 GCGGAGACACCAAGAGAGCTGGG + Intergenic
1175810125 20:61853281-61853303 GCGGAGAGGCTAGGGGAGCAAGG + Intronic
1178441268 21:32600443-32600465 GCGCAGGCACCAAGGCAGGAAGG + Intronic
1184188726 22:42881034-42881056 ACAGAGGCACTGAGAGAGCATGG - Intronic
1184499356 22:44862443-44862465 CCGGAGGCACCTGGGGAGCACGG + Exonic
1184664193 22:45978735-45978757 GCGGCGGCACTGAGGGAGCTGGG + Intergenic
1184737626 22:46408794-46408816 GCGGAGACAGCGAGGGAGCATGG - Intronic
958798819 3:98733185-98733207 GCGGAGGCGTAAAGGGACCATGG + Intronic
963294213 3:143527750-143527772 GCTGAGGCACTGAGGGAAGAAGG - Intronic
967985735 3:195094328-195094350 GAGGAGGCCCCAAGAGAGCAGGG - Intronic
968707538 4:2087339-2087361 GCTGAGGCACTAGGTGAGGATGG - Intronic
969864318 4:10063831-10063853 GCAGAGGCGCTAAGGAAGCCTGG - Intergenic
976095463 4:81503757-81503779 GCGGAGGGAGTAGGGGAGAAGGG + Intronic
979340960 4:119523494-119523516 GAAGAGGCACTAAGGAAGGAAGG + Intronic
980186345 4:129465740-129465762 CTGGATGCACTAAGGGTGCAAGG - Intergenic
980344519 4:131596118-131596140 GCGGAGGGACGAAGGAAGGAAGG - Intergenic
981478366 4:145210723-145210745 GAGGAGGCACTAAGAGATAAGGG + Intergenic
988181407 5:27799009-27799031 GCGGAGGAAGTAAGGGAAGAAGG + Intergenic
989301203 5:39896079-39896101 GAGGAGACACTAAGGGGACATGG + Intergenic
989444418 5:41510698-41510720 GCGGAGGCACTAAGGGAGCACGG - Intergenic
990315404 5:54578437-54578459 GCAGAGCCACTAAGGCCGCAGGG - Intergenic
991192242 5:63888208-63888230 CCAGAGGCACCAAAGGAGCAAGG - Intergenic
991266466 5:64725575-64725597 TCGGAGTCACTAAAGGAGGAAGG - Intronic
996711408 5:126547123-126547145 GCAGAGGCTCTAAGGAACCAAGG + Intronic
996822487 5:127646062-127646084 GAGAAGGCACTAAGGGAGAGGGG + Intergenic
998159274 5:139803906-139803928 GCAGAGGCTACAAGGGAGCATGG + Intronic
998731864 5:145087133-145087155 GAGGAGGAAGAAAGGGAGCAAGG - Intergenic
1000029737 5:157391199-157391221 GCAGAGGCACTGAGGCAGGAAGG + Intronic
1001003779 5:168031706-168031728 GGGGAGGGAGGAAGGGAGCAAGG + Intronic
1001822078 5:174718349-174718371 GTGGAGGCAGAAAGGGAGGAGGG + Intergenic
1002094890 5:176824863-176824885 GCGCAGGCACTGGGGGTGCATGG - Intronic
1005861783 6:29907773-29907795 GAGGAGGCACTGAGAGAGCCTGG - Intergenic
1006175984 6:32121860-32121882 GAGGAGCCACTAAAGGAGAAAGG - Intronic
1006419802 6:33925832-33925854 GGGGTGGCAGTAGGGGAGCAAGG - Intergenic
1006603661 6:35242037-35242059 GCAGAGGGAGTGAGGGAGCAGGG - Intronic
1006604743 6:35248162-35248184 ACGGAGGGACAAAGGTAGCATGG + Intronic
1006996266 6:38264207-38264229 GCGGTGGCACTGGGGAAGCAGGG + Intronic
1007732057 6:43953390-43953412 GAGGTGGCACTAAGGGAACAAGG - Intergenic
1011663447 6:89613587-89613609 GCACAGGCAGAAAGGGAGCAGGG + Intronic
1019348069 7:540125-540147 GAGGAGGCCCGTAGGGAGCAGGG - Intergenic
1019630390 7:2045962-2045984 GGGCAGGCCCTCAGGGAGCAGGG - Intronic
1021239181 7:18179380-18179402 GCTGAGGTCCTAAGGGAGGAGGG + Intronic
1023830330 7:44035442-44035464 CAGAAGGGACTAAGGGAGCAAGG - Intergenic
1023836975 7:44074098-44074120 GCGGTGGCTCTTGGGGAGCAGGG + Intronic
1026199038 7:68198143-68198165 GCGTAGTAACTACGGGAGCAGGG + Intergenic
1028143265 7:87294293-87294315 GCCAAGGCACTTAGGGAGCATGG + Intergenic
1029160046 7:98545046-98545068 GGGGTGACACTGAGGGAGCAAGG - Intergenic
1029740653 7:102489729-102489751 CAGAAGGGACTAAGGGAGCAAGG - Intronic
1029758647 7:102588901-102588923 CAGAAGGGACTAAGGGAGCAAGG - Intronic
1032988176 7:137361830-137361852 GAGGAGGCTCCAGGGGAGCATGG + Intergenic
1034420254 7:150986798-150986820 GAGGAGGCAGGAAGGGGGCAGGG + Intergenic
1036384257 8:8264637-8264659 ACGGGGGCACTAAGGAAGAAAGG - Intergenic
1036658621 8:10693303-10693325 GAGGAGGCAGTAAAGGAGCTGGG - Intronic
1044522668 8:93217510-93217532 CCTGAGGCACAAAAGGAGCAGGG - Intergenic
1045494790 8:102699274-102699296 GAGGAAGCACTGAGGGAGCCTGG + Intergenic
1047929567 8:129713342-129713364 GCTGAGGCTCTCAAGGAGCAAGG + Intergenic
1051343742 9:16134022-16134044 CCGCAGGCACTAAGTGAGCACGG + Intergenic
1053206978 9:36194564-36194586 GCAGTGTCACTAAGGTAGCAAGG + Intronic
1055537948 9:77268407-77268429 CCGGAAGCACAAAGGGATCAGGG - Intronic
1057183249 9:93040974-93040996 GAGGAGGCCCCAAGGGAGCAAGG - Intergenic
1058153161 9:101484201-101484223 GCAGAGGAACAAAGGGAGAAAGG + Intronic
1058718034 9:107739721-107739743 GTGGAGGCTTTCAGGGAGCACGG + Intergenic
1060038777 9:120281844-120281866 GAGGAGGCCCTAAGAGAGAATGG + Intergenic
1061153421 9:128842612-128842634 GTGGAGGCACTGGGGGAGGAAGG - Intronic
1061326425 9:129867462-129867484 GCACAGGGACTGAGGGAGCAGGG + Intronic
1061396926 9:130348491-130348513 GCTGTGGCTCTAAGGGGGCAGGG + Intronic
1187942758 X:24398045-24398067 GCTGACCCAGTAAGGGAGCATGG + Intergenic
1196374757 X:115020923-115020945 GGGGAGGGAATAAGGGAGCCGGG - Intergenic
1197785208 X:130191421-130191443 AGGGAGGCCCTTAGGGAGCAAGG - Intergenic