ID: 989451311

View in Genome Browser
Species Human (GRCh38)
Location 5:41589297-41589319
Sequence ATTTTAACTGAGAGAATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989451311_989451312 15 Left 989451311 5:41589297-41589319 CCTTAAATTCTCTCAGTTAAAAT No data
Right 989451312 5:41589335-41589357 TGTTTTTTTGACTAGACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989451311 Original CRISPR ATTTTAACTGAGAGAATTTA AGG (reversed) Intergenic
No off target data available for this crispr