ID: 989451312

View in Genome Browser
Species Human (GRCh38)
Location 5:41589335-41589357
Sequence TGTTTTTTTGACTAGACTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989451309_989451312 22 Left 989451309 5:41589290-41589312 CCCAATTCCTTAAATTCTCTCAG No data
Right 989451312 5:41589335-41589357 TGTTTTTTTGACTAGACTCTAGG No data
989451310_989451312 21 Left 989451310 5:41589291-41589313 CCAATTCCTTAAATTCTCTCAGT No data
Right 989451312 5:41589335-41589357 TGTTTTTTTGACTAGACTCTAGG No data
989451311_989451312 15 Left 989451311 5:41589297-41589319 CCTTAAATTCTCTCAGTTAAAAT No data
Right 989451312 5:41589335-41589357 TGTTTTTTTGACTAGACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989451312 Original CRISPR TGTTTTTTTGACTAGACTCT AGG Intergenic
No off target data available for this crispr