ID: 989455454

View in Genome Browser
Species Human (GRCh38)
Location 5:41638342-41638364
Sequence TTCCTACCACAAAGCCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989455451_989455454 3 Left 989455451 5:41638316-41638338 CCTTCCTCTTTCTTTTCCTTTTT No data
Right 989455454 5:41638342-41638364 TTCCTACCACAAAGCCCAAGTGG No data
989455448_989455454 11 Left 989455448 5:41638308-41638330 CCTTCTCCCCTTCCTCTTTCTTT No data
Right 989455454 5:41638342-41638364 TTCCTACCACAAAGCCCAAGTGG No data
989455452_989455454 -1 Left 989455452 5:41638320-41638342 CCTCTTTCTTTTCCTTTTTCTAT No data
Right 989455454 5:41638342-41638364 TTCCTACCACAAAGCCCAAGTGG No data
989455450_989455454 4 Left 989455450 5:41638315-41638337 CCCTTCCTCTTTCTTTTCCTTTT No data
Right 989455454 5:41638342-41638364 TTCCTACCACAAAGCCCAAGTGG No data
989455446_989455454 25 Left 989455446 5:41638294-41638316 CCTCCTTTATTCTTCCTTCTCCC No data
Right 989455454 5:41638342-41638364 TTCCTACCACAAAGCCCAAGTGG No data
989455447_989455454 22 Left 989455447 5:41638297-41638319 CCTTTATTCTTCCTTCTCCCCTT No data
Right 989455454 5:41638342-41638364 TTCCTACCACAAAGCCCAAGTGG No data
989455449_989455454 5 Left 989455449 5:41638314-41638336 CCCCTTCCTCTTTCTTTTCCTTT 0: 2
1: 7
2: 148
3: 1393
4: 7805
Right 989455454 5:41638342-41638364 TTCCTACCACAAAGCCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989455454 Original CRISPR TTCCTACCACAAAGCCCAAG TGG Intergenic
No off target data available for this crispr