ID: 989457073

View in Genome Browser
Species Human (GRCh38)
Location 5:41656775-41656797
Sequence TGTGTCATGCAGTCCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989457073_989457074 1 Left 989457073 5:41656775-41656797 CCTGCTGGGGACTGCATGACACA No data
Right 989457074 5:41656799-41656821 AGCTGACATCATCTGACACCAGG No data
989457073_989457077 26 Left 989457073 5:41656775-41656797 CCTGCTGGGGACTGCATGACACA No data
Right 989457077 5:41656824-41656846 ACTGCTCAGTAATTACAAGGTGG No data
989457073_989457078 27 Left 989457073 5:41656775-41656797 CCTGCTGGGGACTGCATGACACA No data
Right 989457078 5:41656825-41656847 CTGCTCAGTAATTACAAGGTGGG No data
989457073_989457076 23 Left 989457073 5:41656775-41656797 CCTGCTGGGGACTGCATGACACA No data
Right 989457076 5:41656821-41656843 GTGACTGCTCAGTAATTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989457073 Original CRISPR TGTGTCATGCAGTCCCCAGC AGG (reversed) Intergenic
No off target data available for this crispr