ID: 989457078

View in Genome Browser
Species Human (GRCh38)
Location 5:41656825-41656847
Sequence CTGCTCAGTAATTACAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989457073_989457078 27 Left 989457073 5:41656775-41656797 CCTGCTGGGGACTGCATGACACA No data
Right 989457078 5:41656825-41656847 CTGCTCAGTAATTACAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989457078 Original CRISPR CTGCTCAGTAATTACAAGGT GGG Intergenic
No off target data available for this crispr