ID: 989459626

View in Genome Browser
Species Human (GRCh38)
Location 5:41682578-41682600
Sequence ATGAATAAACAAATGATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989459625_989459626 28 Left 989459625 5:41682527-41682549 CCTTTGTGAATTTCAACACTTTA No data
Right 989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989459626 Original CRISPR ATGAATAAACAAATGATCAA TGG Intergenic
No off target data available for this crispr