ID: 989466254

View in Genome Browser
Species Human (GRCh38)
Location 5:41758934-41758956
Sequence CTGTGTGCCCAGATAAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989466252_989466254 -6 Left 989466252 5:41758917-41758939 CCAGTCACTGGGTTTATCTGTGT 0: 1
1: 0
2: 3
3: 15
4: 186
Right 989466254 5:41758934-41758956 CTGTGTGCCCAGATAAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989466254 Original CRISPR CTGTGTGCCCAGATAAAACA GGG Intronic
No off target data available for this crispr