ID: 989468209

View in Genome Browser
Species Human (GRCh38)
Location 5:41782625-41782647
Sequence ACTAATATCCAGAGTCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6371
Summary {0: 1, 1: 3, 2: 93, 3: 1381, 4: 4893}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989468209_989468212 24 Left 989468209 5:41782625-41782647 CCTTCCAGACTCTGGATATTAGT 0: 1
1: 3
2: 93
3: 1381
4: 4893
Right 989468212 5:41782672-41782694 AATATTTTCTCACATTCTGTAGG 0: 44
1: 2850
2: 14540
3: 18082
4: 10017
989468209_989468211 -9 Left 989468209 5:41782625-41782647 CCTTCCAGACTCTGGATATTAGT 0: 1
1: 3
2: 93
3: 1381
4: 4893
Right 989468211 5:41782639-41782661 GATATTAGTCATTTTTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989468209 Original CRISPR ACTAATATCCAGAGTCTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr