ID: 989468209 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:41782625-41782647 |
| Sequence | ACTAATATCCAGAGTCTGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 6371 | |||
| Summary | {0: 1, 1: 3, 2: 93, 3: 1381, 4: 4893} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 989468209_989468212 | 24 | Left | 989468209 | 5:41782625-41782647 | CCTTCCAGACTCTGGATATTAGT | 0: 1 1: 3 2: 93 3: 1381 4: 4893 |
||
| Right | 989468212 | 5:41782672-41782694 | AATATTTTCTCACATTCTGTAGG | 0: 44 1: 2850 2: 14540 3: 18082 4: 10017 |
||||
| 989468209_989468211 | -9 | Left | 989468209 | 5:41782625-41782647 | CCTTCCAGACTCTGGATATTAGT | 0: 1 1: 3 2: 93 3: 1381 4: 4893 |
||
| Right | 989468211 | 5:41782639-41782661 | GATATTAGTCATTTTTCAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 989468209 | Original CRISPR | ACTAATATCCAGAGTCTGGA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||