ID: 989468227

View in Genome Browser
Species Human (GRCh38)
Location 5:41782832-41782854
Sequence AAACTACAGACAGAAGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 419}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989468224_989468227 5 Left 989468224 5:41782804-41782826 CCTGTGTAGTGGAAAGAGCATCC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 989468227 5:41782832-41782854 AAACTACAGACAGAAGAGATAGG 0: 1
1: 0
2: 4
3: 39
4: 419
989468223_989468227 6 Left 989468223 5:41782803-41782825 CCCTGTGTAGTGGAAAGAGCATC 0: 1
1: 1
2: 2
3: 19
4: 178
Right 989468227 5:41782832-41782854 AAACTACAGACAGAAGAGATAGG 0: 1
1: 0
2: 4
3: 39
4: 419
989468222_989468227 7 Left 989468222 5:41782802-41782824 CCCCTGTGTAGTGGAAAGAGCAT 0: 1
1: 1
2: 2
3: 17
4: 217
Right 989468227 5:41782832-41782854 AAACTACAGACAGAAGAGATAGG 0: 1
1: 0
2: 4
3: 39
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989468227 Original CRISPR AAACTACAGACAGAAGAGAT AGG Intronic
901883273 1:12206370-12206392 AAAAAAAAGACAGAAGAGACAGG + Intronic
902602221 1:17547762-17547784 AAAATACAGAGAGAAGAAAATGG + Intronic
903403690 1:23078608-23078630 TAACCACAGTCAGAAGACATTGG + Intronic
904552460 1:31331011-31331033 ATAAAACAGACTGAAGAGATGGG + Intronic
904657020 1:32056545-32056567 AAACTTGAGATAGAAGAGTTTGG + Intronic
904997006 1:34639152-34639174 CATCTACAGACAAAAGAGAGGGG + Intergenic
905972491 1:42152750-42152772 AAAGCACAGACAGGTGAGATGGG + Intergenic
906176865 1:43781986-43782008 AAAATACAGACTGAAAAAATAGG - Intronic
906546620 1:46623987-46624009 CAAGTACAGACAGAAGAAAGGGG + Intergenic
906926062 1:50118132-50118154 AATATACAGACAGCAAAGATGGG - Intronic
907140275 1:52180050-52180072 AATGTACAGACAGCAGAGACTGG + Intronic
907994944 1:59620815-59620837 AAACTACAGCGTGAAGAGCTGGG - Intronic
908489301 1:64627068-64627090 GAACTAGAGACAGCAGAGACTGG + Intronic
908565045 1:65345756-65345778 ACTCTACATACAGAAGACATGGG - Intronic
908601231 1:65742532-65742554 ACCCTACAAACAGAAGAGAGAGG - Intergenic
909194282 1:72596845-72596867 CAAATACAGACAGAATAGAAGGG + Intergenic
909415857 1:75404509-75404531 ACCCTACAGCCAGAAGAGAGTGG + Intronic
909854010 1:80505445-80505467 ATTCTAAAGACAGAAGAGATAGG - Intergenic
911778288 1:101842773-101842795 AAACTGCAGAGAGAGGAGTTCGG - Intronic
912283140 1:108338980-108339002 AAACCATTGAAAGAAGAGATAGG + Intergenic
912313626 1:108647069-108647091 AAACAGCAGAAAGAAGAGAAGGG - Intergenic
912644983 1:111383798-111383820 AAATTACAGAGAAAAGACATGGG + Intergenic
913274755 1:117126083-117126105 AAGATAAAGACAGAAGAGAGAGG - Intergenic
914458241 1:147856656-147856678 ACCCTACAGCCAGAAGAGAGTGG + Intergenic
915819518 1:159006879-159006901 AAATTACGGACATAAAAGATGGG - Intronic
916444632 1:164860940-164860962 AAAATACAGAGAGAAGGGGTGGG + Intronic
916568695 1:166006409-166006431 ACCCTAAAGCCAGAAGAGATTGG - Intergenic
918893597 1:190310020-190310042 AATATACAGACACTAGAGATTGG - Intronic
919416572 1:197317884-197317906 AAACTACTAACAGAAAACATAGG + Intronic
919804282 1:201371810-201371832 AAATGGCAGACAGAAGAGACAGG + Intronic
920031434 1:203039582-203039604 GAATCACAGACAGTAGAGATGGG + Intronic
920414258 1:205787992-205788014 CAAATACAGGCAGAAGAGCTGGG + Intergenic
921623611 1:217353791-217353813 AAACTAAAGACAAATGAGAATGG - Intergenic
921832758 1:219746479-219746501 AAAGAACAGGCAGAAAAGATGGG - Intronic
922554581 1:226522949-226522971 AAACCACAGGCAGAAAAGAATGG - Intergenic
922805493 1:228385467-228385489 ATACTACAGATAGAAGAGATAGG + Intergenic
923115716 1:230935759-230935781 AGACTAGAGACAGAAGGGAATGG + Intronic
923720157 1:236459978-236460000 AAAGCACAGACAGAAGAGGAAGG - Intronic
923745125 1:236693033-236693055 AAAGAACAGAAAGCAGAGATTGG + Intronic
924847702 1:247789749-247789771 AAAATGCAGACAGAGGAGAAGGG - Intergenic
924896510 1:248342436-248342458 AAACTACTAACAGAAAACATTGG - Intergenic
1063011937 10:2030897-2030919 AAACTATAGAGACAAGAGAAAGG - Intergenic
1063190034 10:3684943-3684965 AAACTAAAGACAGAAAACAAAGG + Intergenic
1063775307 10:9256645-9256667 AGACAGCAGAGAGAAGAGATTGG + Intergenic
1064178665 10:13097059-13097081 TAACTCCAAACAGAGGAGATTGG + Intronic
1064960799 10:20963087-20963109 AAAGTACAGAGAGAAGAATTAGG - Intronic
1065653080 10:27914818-27914840 AAACTAGACACAGAAGAGAAAGG + Intronic
1066076840 10:31887461-31887483 AAACTGCAGACATACGAAATCGG + Intronic
1066798193 10:39149833-39149855 AAACTACTGAAAGAAAAGAGAGG - Intergenic
1067900752 10:50239044-50239066 AAACTGAAGACAGAAGTGAGCGG - Intronic
1068147275 10:53088084-53088106 AAACTACAGTCAGAGGGCATAGG - Intergenic
1068824703 10:61422562-61422584 AAAATAATGACAGAAGAAATTGG + Intronic
1071144784 10:82555877-82555899 AAACAACAGGTAGAAGAAATAGG - Intronic
1071995158 10:91140651-91140673 AAACTCCAGGGAGAAGAGAGGGG + Intergenic
1072934292 10:99697419-99697441 AAACAGCAGACAGAAAAGAAAGG - Intronic
1074723164 10:116281347-116281369 AAATAACAGTCAGAGGAGATAGG + Intergenic
1078584608 11:12571863-12571885 AAACTACTGAAAGAAAACATTGG + Intergenic
1078806789 11:14713876-14713898 ACACTACAGGCAGAGGAAATAGG + Intronic
1079053771 11:17187299-17187321 AAACTACAGAGAGATGACACAGG + Intronic
1080289851 11:30658635-30658657 ATTCTTCAGAGAGAAGAGATGGG - Intergenic
1081541675 11:44039124-44039146 AAACAAATGACAGAGGAGATGGG + Intergenic
1082194208 11:49282498-49282520 AATCTAGGGACAGAAGAGGTAGG + Intergenic
1082311515 11:50655207-50655229 AAACTGCTGAAAGAAAAGATAGG - Intergenic
1082592105 11:55024576-55024598 AAACTACAGAATGAAAAGAAAGG + Intergenic
1083819539 11:65160277-65160299 AATGTACAGACAGCAGAGACTGG - Intergenic
1084406611 11:68977920-68977942 TAACCACACACAGAAGTGATCGG + Intergenic
1086671944 11:89558541-89558563 AATCTAGGGACAGAAGAGGTGGG - Intergenic
1086733001 11:90271690-90271712 AAAGAAGAAACAGAAGAGATTGG - Intergenic
1087247899 11:95861177-95861199 GAACTAGAAACAGAAAAGATAGG + Intronic
1087997885 11:104833930-104833952 AAACTACTGAAAGAAAACATAGG - Intergenic
1088982893 11:114879615-114879637 AAACTATAGACCCAAGAGATGGG + Intergenic
1089112109 11:116065233-116065255 AAACTACAGACAGCTGAGCTTGG - Intergenic
1089145765 11:116328801-116328823 ATACAACAGGCAGCAGAGATGGG + Intergenic
1089224162 11:116901590-116901612 AAAGTACAGACAGAGTAGATAGG - Intronic
1089441314 11:118519800-118519822 AAACTGCTGACAGAAAAGAAGGG - Intronic
1090548784 11:127795601-127795623 TAACTACAGACACAAGTGTTAGG + Intergenic
1090549196 11:127800869-127800891 AAACTACAGATGGAAGAAAATGG - Intergenic
1092637085 12:10463483-10463505 ACTCTACAGCCAGAAGAGACTGG - Intergenic
1095788662 12:46139590-46139612 AAACTACCAAAAGAAGACATTGG - Intergenic
1097740463 12:63235858-63235880 AAACTCCAGAGTGAAGAGAGAGG - Intergenic
1099269476 12:80489297-80489319 AAACTAGTGACAGCAGAGGTAGG - Intronic
1099630335 12:85134337-85134359 AAATAACAGTCACAAGAGATGGG - Intronic
1099945686 12:89241188-89241210 AAACTACTGAAAGAAAACATTGG - Intergenic
1101267235 12:103101888-103101910 AGACTACATGCAGCAGAGATAGG - Intergenic
1101677384 12:106930484-106930506 AAACTACAGGAAGAAAACATAGG + Intergenic
1103522589 12:121546352-121546374 AAAAAAAAGACAGAGGAGATGGG - Intronic
1103851226 12:123934803-123934825 TAACTACAGTCAGAAGAGGAAGG - Exonic
1105663529 13:22526541-22526563 ACCCTACAGCCAGAAGAGAGTGG + Intergenic
1106282277 13:28286201-28286223 ATACCACAGACAGTAGAGGTTGG - Intronic
1107550869 13:41473995-41474017 AAACTACAAAAAGAAAACATTGG - Intergenic
1108038939 13:46321388-46321410 AAACCAGAGAGAGAAGAGAGAGG - Intergenic
1108549413 13:51528193-51528215 ACCCTACAGCCAGAAGAGAGTGG + Intergenic
1108859101 13:54831238-54831260 AAACTACTGAAAGAAAATATTGG + Intergenic
1109516872 13:63454946-63454968 AAAATACAGTTAGAAGAAATAGG + Intergenic
1109676544 13:65683132-65683154 GATCAACAGACAGAACAGATAGG - Intergenic
1110098436 13:71562381-71562403 AAGAGACAGAGAGAAGAGATGGG + Intronic
1111882000 13:93969266-93969288 AAAATACAGAGAGATGTGATGGG + Intronic
1112665389 13:101565992-101566014 AAAGTATACACAGTAGAGATGGG - Intronic
1112681174 13:101766506-101766528 AAAATAGACACAGAAGATATGGG + Intronic
1113845522 13:113387648-113387670 TAAATACAGACAGAAGATAAAGG - Intergenic
1114035804 14:18626316-18626338 AAACTTCAAAAAGAACAGATAGG - Intergenic
1114122833 14:19688706-19688728 AAACTTCAAAAAGAACAGATAGG + Intergenic
1115141109 14:30172436-30172458 AAAATACAGATAAAAGGGATAGG - Intronic
1116302706 14:43205806-43205828 AAACTACAGAAGGAAGAGAGTGG + Intergenic
1119384308 14:74247674-74247696 AGACTTCAAACAGAAGAGGTGGG - Intronic
1119510374 14:75206745-75206767 CCAATACAGACAGAAGAGAGTGG - Intergenic
1120076965 14:80169817-80169839 AAACTACAGACAGAATCCAAAGG - Intergenic
1120421215 14:84288443-84288465 AAACTATAGGCAAAAGATATTGG - Intergenic
1120931541 14:89853840-89853862 TAATTAAAGACAGAAGAGTTAGG + Intronic
1123386941 15:19821811-19821833 AAAATATAGACAGAAGAAATCGG - Intergenic
1125353387 15:38790936-38790958 AAAACACAGGAAGAAGAGATGGG - Intergenic
1126067480 15:44837222-44837244 AAACTACATCAAGGAGAGATGGG + Intergenic
1126092397 15:45063659-45063681 AAACTACATCGAGGAGAGATGGG - Intronic
1126277631 15:46902785-46902807 CAACTACAAGCAAAAGAGATTGG + Intergenic
1126394697 15:48202114-48202136 ATTCGACAAACAGAAGAGATAGG - Exonic
1126397802 15:48237729-48237751 TAACTACAGACAATAGAGTTTGG + Intronic
1126781676 15:52144313-52144335 AAATTACAGAAAGAATATATTGG - Intronic
1127492990 15:59482992-59483014 AAGCTACAGAAATAATAGATAGG + Intronic
1127677114 15:61250623-61250645 GAAGTACAGAGACAAGAGATAGG - Intergenic
1128625922 15:69203336-69203358 ATGCTACAGAGAGAAGAGACAGG + Intronic
1129857120 15:78832305-78832327 AAACTGAAGCCAGAGGAGATGGG - Intronic
1131718134 15:95135972-95135994 AAACTACAGGTAGAACAAATTGG + Intergenic
1132018600 15:98340530-98340552 ACACGACAGAGAGAAGAGCTGGG + Intergenic
1132526710 16:419924-419946 AGAGGACAGACAGAAGAGAAAGG - Intergenic
1136592593 16:31226442-31226464 AAACAACAAAAAGAAGACATTGG + Intergenic
1138776660 16:59731138-59731160 ACCCTACAAGCAGAAGAGATTGG + Intronic
1139535611 16:67571047-67571069 AAACTGAAGACAGAAAAAATTGG - Intronic
1141255208 16:82395774-82395796 AAGCTACAGAGAGAAGACCTAGG - Intergenic
1203013662 16_KI270728v1_random:327695-327717 AAACTGCAGAAAGAAAAGAAAGG - Intergenic
1203031997 16_KI270728v1_random:600854-600876 AAACTGCAGAAAGAAAAGAAAGG - Intergenic
1203039724 16_KI270728v1_random:733577-733599 AAACTGCAGAAAGAAAAGAAAGG + Intergenic
1142908076 17:3061990-3062012 GAACTACAGAAATAAAAGATAGG + Intergenic
1142926488 17:3242271-3242293 GAACTACAGAAATAAAAGATAGG - Intergenic
1143195488 17:5073213-5073235 ATTCTACAGATAGAAGAGAAGGG + Intergenic
1144114587 17:12074930-12074952 AAAAAACAGACAGAATATATAGG - Intronic
1144207756 17:12991003-12991025 AACCTCCAGAAAGAAGAGACAGG - Exonic
1150758702 17:67940208-67940230 ATCCTACAGACAGCAGAGACTGG + Intronic
1152169658 17:78736174-78736196 AAAGTAAAGACATTAGAGATCGG - Intronic
1152909903 17:82996937-82996959 AAACTACTGAAAGAAAACATTGG + Intronic
1153491431 18:5653014-5653036 AAACTGCAAACAGAAAAAATTGG + Intergenic
1154475990 18:14758382-14758404 AAACAACAAAAAGAAGAGAATGG - Intronic
1155704401 18:28790728-28790750 CAACTAAAGACAAAAAAGATTGG - Intergenic
1155775565 18:29756388-29756410 CAACTACAGACTGAGGAAATGGG + Intergenic
1155966703 18:32042483-32042505 CAACCACAGACTGGAGAGATTGG + Intronic
1157044949 18:44090888-44090910 AAATTACAAACAGAAAAGAGAGG - Intergenic
1157146236 18:45165490-45165512 AAACTTCTCACAGAAGTGATGGG - Intergenic
1159043627 18:63347655-63347677 AGACCACAGAAGGAAGAGATGGG + Intronic
1159802179 18:72914775-72914797 AAACTACTGAAAGAAAACATTGG - Intergenic
1161199106 19:3004724-3004746 CAATTACAGAAAGAAGAGAAAGG + Intronic
1162860715 19:13504594-13504616 AAACCACATACAAAAGGGATAGG + Intronic
1164709819 19:30347746-30347768 AAGATTCAGACAGAAGAAATAGG + Intronic
1166420599 19:42633246-42633268 GAAACACAGACAGAAGAGAAAGG - Intronic
1168096018 19:54115306-54115328 AACCTACAGATTGAAGAGGTCGG - Exonic
1168432928 19:56295617-56295639 CAAAAACAAACAGAAGAGATGGG + Intronic
925588749 2:5489127-5489149 AAACTACTGAAAGAAAACATTGG + Intergenic
927306029 2:21574161-21574183 AAACAACAGACAACAAAGATGGG - Intergenic
927800266 2:26092391-26092413 AAACTAGAGACAGCACATATAGG + Intronic
928218902 2:29386181-29386203 TAACTACAGAGAGAAAAGATAGG - Intronic
928402784 2:30991349-30991371 AAACTGCAGATAGGAGAGAGGGG - Intronic
929309893 2:40410414-40410436 AAACTATAGATAGAATATATGGG - Intronic
929617478 2:43323381-43323403 AAACTAGAGACAAAAGATAGGGG - Intronic
931003017 2:57811059-57811081 AAACAACAAACAGAAAAGAAGGG + Intergenic
931193920 2:60032123-60032145 TACCTACAGAGAGAAAAGATCGG + Intergenic
931461085 2:62450663-62450685 CATCTAAAGACAGAAGAAATAGG - Intergenic
931521414 2:63101306-63101328 AAACTACTGGAAGAAGACATAGG - Intergenic
931972874 2:67609351-67609373 AAATCACTTACAGAAGAGATGGG + Intergenic
932747373 2:74344999-74345021 AAAATATAGACATAAGAGGTGGG + Intronic
933080918 2:77984561-77984583 AAACTACAGGAAGAAAACATTGG + Intergenic
933152974 2:78937118-78937140 AAACTACAATCAGAGGAAATGGG - Intergenic
933166968 2:79087079-79087101 AAACTAGAGAGAAAAGAGATAGG - Intronic
933170657 2:79121399-79121421 AAACCAAAGACAGAAGATGTAGG + Intronic
934082694 2:88483065-88483087 AAGCTGAAGACAGAAGAGGTTGG - Intergenic
935708235 2:105874817-105874839 AAATTACAGACATTAAAGATTGG - Intronic
935854358 2:107258580-107258602 AAAGTAAAGAGAGAAGAGATAGG + Intergenic
936227296 2:110668345-110668367 AAGCTCCAGACAGTAGAGATGGG - Intronic
937386125 2:121434981-121435003 AGACTACAGATAGAAGACAAAGG - Intronic
937517785 2:122674955-122674977 ACACTCCAGACAGAAGAAAAAGG - Intergenic
938687335 2:133752210-133752232 AAACTACTGAAAGAAAATATAGG + Intergenic
938760158 2:134417943-134417965 AAACTGCAGTAAGAAAAGATAGG - Intronic
938903664 2:135819384-135819406 AAATTACAGCCAGCAGAGGTCGG + Intronic
939130827 2:138234094-138234116 AAACTACAGACAGCAGAAACAGG + Intergenic
940012309 2:149067529-149067551 AAATTATACACAGAAAAGATAGG - Intronic
940947338 2:159632960-159632982 AGACTACAGACACAAGGGTTGGG + Intergenic
941169858 2:162123176-162123198 AAAATAGAGACAGAAGAAAACGG - Intergenic
941321229 2:164057604-164057626 ATAAGACAGACAGAAGATATTGG - Intergenic
941894408 2:170614801-170614823 TTTCTAAAGACAGAAGAGATAGG - Intronic
942447897 2:176090459-176090481 AAAATTCAGCCAGAAGTGATGGG + Intergenic
943117103 2:183686443-183686465 AAACTACAAAAAGAAAATATTGG - Intergenic
943722825 2:191222851-191222873 AATATACTCACAGAAGAGATGGG - Intergenic
944035695 2:195291824-195291846 ACCCTAAAGCCAGAAGAGATTGG + Intergenic
945014337 2:205499256-205499278 AAAGTACAGAGAGAAGAACTTGG + Intronic
945307536 2:208272596-208272618 AAACAAAAGACAAAAGATATAGG - Intronic
946569094 2:221001639-221001661 AATCTACCGACAGAAGAGAAGGG - Intergenic
946722052 2:222619379-222619401 AAAGTTCAGACAAGAGAGATTGG + Intronic
947686639 2:232091995-232092017 AAACTACAGAAAGAAAACATTGG - Intronic
948770198 2:240247918-240247940 AAAGGACAGACAGAAGGGTTTGG - Intergenic
1171064352 20:21999137-21999159 AAACTACAGGAAGAAAACATAGG + Intergenic
1172305999 20:33881227-33881249 AAACAAAAGACAGAAGACATGGG - Intergenic
1172343237 20:34175921-34175943 AAAAGACAGAGAGAAAAGATGGG + Intergenic
1172980629 20:38938915-38938937 AAACTGATGCCAGAAGAGATTGG - Intronic
1173828110 20:46060226-46060248 TGACCACCGACAGAAGAGATGGG + Intergenic
1174012516 20:47461971-47461993 AAACAAAAAACAGAAGTGATTGG - Intergenic
1175694923 20:61095219-61095241 AAAATACATAAAGAAAAGATGGG + Intergenic
1177426068 21:20923908-20923930 ACCCTACAGCCAGAAGAGAGTGG + Intergenic
1177515943 21:22151542-22151564 AAACTAAAGACAGAAAAAAATGG - Intergenic
1178723273 21:35028949-35028971 ACACTGCAGACAGATGAGCTAGG - Intronic
1179312838 21:40212031-40212053 AAGCTGCAGAGAGCAGAGATTGG - Intronic
1179836358 21:44036472-44036494 GAACTGCACACAGAAGTGATGGG - Intronic
1180459925 22:15553370-15553392 AAACTTCAAAAAGAACAGATAGG - Intergenic
1180509479 22:16065508-16065530 AAAATATAGACAGAAGAAATCGG - Intergenic
1181655207 22:24292049-24292071 TAACTACAGAATGGAGAGATTGG + Intronic
1182515747 22:30857973-30857995 ACACTGCAGACAGAAGAGGCGGG + Intronic
949747271 3:7309701-7309723 TAAGTACAGATAGAAGAGAAAGG - Intronic
949818151 3:8084597-8084619 ACAATACAGACAGAAAAGACTGG - Intergenic
951055175 3:18139162-18139184 ACACTAGACACAGAAGACATTGG + Intronic
952189943 3:31012202-31012224 AAACTACACACAGATGAAATAGG - Intergenic
953070456 3:39514733-39514755 GAAAAACAGAGAGAAGAGATGGG - Exonic
953243258 3:41168082-41168104 AAACTAAAGACAGACGAGGGAGG + Intergenic
953573784 3:44096325-44096347 AAACTGCAGAAAGATGAGAATGG - Intergenic
954085020 3:48237511-48237533 AAACTCCTGACAGAACTGATGGG - Intergenic
954431525 3:50473303-50473325 AAACTGCAGACAGTAGCGTTTGG - Intronic
954480416 3:50795062-50795084 AAACCCAAGCCAGAAGAGATTGG - Intronic
954485634 3:50848617-50848639 AACTTACAAACAGGAGAGATTGG - Intronic
955314035 3:57920423-57920445 AAACATTAGACAGGAGAGATGGG - Intronic
956935508 3:74096409-74096431 AAACAACACACAGAAGAATTTGG - Intergenic
957590279 3:82188099-82188121 ATCTTACAGACAGAAGGGATTGG - Intergenic
957807839 3:85173791-85173813 ATACTACATACAGAAGAATTGGG - Intronic
959123920 3:102267121-102267143 AAATTTCAGACAGAAGGAATGGG + Intronic
959259406 3:104056046-104056068 AAACTACTGAAAGAAAACATTGG + Intergenic
959484834 3:106914757-106914779 AAACAAGAGAGAGAAGAGATAGG + Intergenic
959656303 3:108808644-108808666 TAACTATAGATAGCAGAGATAGG + Intergenic
959857753 3:111179531-111179553 AATACACAGACAGAAGACATTGG + Intronic
960209616 3:114945607-114945629 AAAGTTAAGACAGAAGAAATGGG + Intronic
961576511 3:127841202-127841224 GAACTATAAACAGAATAGATGGG + Intergenic
961859103 3:129900405-129900427 AAAGTACAGAAAGAAAAGAAAGG + Intergenic
962305848 3:134285257-134285279 AAACTACTGAAAGAAAACATTGG + Intergenic
962621676 3:137186511-137186533 AATCTTCAGCTAGAAGAGATGGG - Intergenic
962925991 3:139993808-139993830 AAAATACTGACAGATGTGATGGG + Intronic
964243842 3:154627450-154627472 AAACTACTAAAAGAAAAGATAGG + Intergenic
964609803 3:158600905-158600927 AAACTACAGGGAGAAGAGTTAGG - Intronic
964927989 3:161979904-161979926 AAACTACTGAAAGAAAACATTGG - Intergenic
965020761 3:163227460-163227482 CAATTATATACAGAAGAGATAGG - Intergenic
965739363 3:171857435-171857457 AAACTACTGAAAGAAAACATAGG + Intronic
965940921 3:174180865-174180887 GAACTATAGACAGGAGAGAATGG + Intronic
966220192 3:177544095-177544117 AAACTATAGGCACAAGAAATAGG - Intergenic
967126015 3:186425464-186425486 GAACTTCAGAGAGAAGAGAAAGG + Intergenic
967738338 3:192978243-192978265 AAACTATTGACAGAAAACATAGG + Intergenic
967794022 3:193578916-193578938 ATCCTACAGTCAGAAGAGATAGG - Intronic
967803926 3:193696632-193696654 GAACTACAGACACAAGACACAGG - Exonic
968130591 3:196190664-196190686 AAAATGGAGACAGAAGAGAAAGG + Intergenic
969996766 4:11320996-11321018 AAACTACGGAAAGAAAACATAGG + Intergenic
970683942 4:18543822-18543844 CAACTACAGAAAGAAAAGATGGG - Intergenic
971315755 4:25566519-25566541 AAGTCACAGAGAGAAGAGATGGG - Intergenic
971585125 4:28395813-28395835 TAACTTCAGAAAGAAGAGAATGG + Intronic
971595902 4:28528130-28528152 AAAATACAGTGAGAAGAGCTAGG + Intergenic
971932989 4:33108952-33108974 AAACTACGGACAGCAGAGTCTGG + Intergenic
971988900 4:33865747-33865769 AACCTACAGCCAGGAGAGAGTGG + Intergenic
972874771 4:43344628-43344650 GAACTACAGACAAATGACATCGG - Intergenic
972987774 4:44785589-44785611 AAACTCCAAGTAGAAGAGATGGG - Intergenic
973269925 4:48252459-48252481 AACCTAGAGCCAGAAGAGCTGGG + Intronic
974599138 4:64053698-64053720 AAAACACAGACAGAGGACATTGG - Intergenic
975503775 4:75116462-75116484 AAAAAACACACAGAAGAGATAGG + Intergenic
975894327 4:79069096-79069118 AAACTACTGGAAGAAGACATTGG + Intergenic
976311011 4:83613573-83613595 AAACTATAGCAAGAAGAGATGGG - Intergenic
976344750 4:83987627-83987649 AAACTAAATATAGAAGAGACAGG + Intergenic
976862883 4:89687751-89687773 AAAGAACAAACAGAAGAGTTAGG - Intergenic
977071926 4:92401869-92401891 ATACTACAGAGAAAAGATATGGG - Intronic
977144538 4:93421117-93421139 AGACTACACACAGCAGAGAAAGG - Intronic
977410652 4:96658109-96658131 AAACTACTGAAAGAAAACATAGG + Intergenic
977523445 4:98114901-98114923 AAAATACAGACAGAAAACAAAGG + Intronic
977795259 4:101156951-101156973 AAACTACAGACAAAATAGGCAGG + Intronic
977855130 4:101880963-101880985 AAACTACTGAAAGAAAACATTGG + Intronic
978552004 4:109937842-109937864 ATCCTACAGCCAGAAGAGAGTGG - Intronic
978670211 4:111239110-111239132 AAAGTAGAAACAGAAGAAATAGG + Intergenic
979648357 4:123099452-123099474 AAACTACTGAAAGAAGTTATAGG - Intronic
980025363 4:127759652-127759674 AAACTACTGAGAGGGGAGATGGG + Intronic
980119509 4:128713352-128713374 AAGCAACAGACAGAAGAAAATGG - Intergenic
980762728 4:137256882-137256904 AAACTACCCACAGATGAGAGAGG + Intergenic
981072547 4:140559020-140559042 AAACTGCATGCAGAAGAGATAGG - Intergenic
981374099 4:143993653-143993675 AACCTAAAGACAGGAGAGAGTGG + Intergenic
981545639 4:145890443-145890465 AAACTACAGGGAGATGAGTTGGG - Intronic
981634362 4:146859177-146859199 AAACTACAGATAGAATAAATGGG + Intronic
982574707 4:157095350-157095372 AAACTACAGGAAGAGTAGATAGG + Intronic
982638861 4:157931615-157931637 GAATTCCAGAAAGAAGAGATAGG - Intergenic
983731984 4:171006756-171006778 AAACTGCACATAGAACAGATGGG - Intergenic
984062411 4:175006540-175006562 ATACTACAGAAAGCAGAGAAAGG + Intergenic
986061356 5:4194759-4194781 AAACGACAGAAAGAAGGGAAAGG + Intergenic
986577698 5:9229627-9229649 AAATTACAAACAGAATAGAAGGG + Intronic
987056481 5:14198293-14198315 AGAATACAGACAGCAGAGAGAGG - Intronic
987151992 5:15051522-15051544 AAACAACAGAGTGAAGAGAATGG - Intergenic
987865848 5:23536920-23536942 CTACTACAGTCTGAAGAGATTGG - Intergenic
988339632 5:29953476-29953498 AAAATACAAACAGAAGATAGTGG + Intergenic
988375595 5:30431344-30431366 AAACAACATAAAAAAGAGATTGG - Intergenic
989210575 5:38855239-38855261 GAAGTACAGACAGAAAAGCTAGG - Intronic
989468227 5:41782832-41782854 AAACTACAGACAGAAGAGATAGG + Intronic
989846680 5:46153015-46153037 AAACTACTGAAAGAAAAGAAAGG - Intergenic
989853146 5:46241486-46241508 AAACTGCTGAAAGAAGAGAAAGG + Intergenic
990854188 5:60244835-60244857 AAACTACTGAAAGAAAACATTGG + Intronic
992128689 5:73668688-73668710 AAAATGCAGACAAAAGAGAGAGG + Intronic
992493949 5:77273281-77273303 AAATTACAGATAGAATTGATAGG - Intronic
993130620 5:83893624-83893646 ACATTAGAGACAGAAGAAATGGG + Intergenic
993187330 5:84636328-84636350 CAACTGCAGAAAGAAGAGATGGG - Intergenic
993236690 5:85319825-85319847 AAATTTCATACAGAAGATATGGG - Intergenic
993356471 5:86915091-86915113 AAACTACAGTAAGAAGATAATGG + Intergenic
994124517 5:96154441-96154463 AAACTACATATAGAACATATGGG - Intergenic
994275102 5:97826876-97826898 AAACTACAGAAACATTAGATCGG - Intergenic
994453621 5:99977233-99977255 AAACTAAAGAAAGAACAGTTTGG + Intergenic
994644189 5:102449192-102449214 ACTCTACAACCAGAAGAGATTGG - Intronic
996006018 5:118421357-118421379 ACTCTACAGCCAGAAGAGATTGG + Intergenic
996166932 5:120235624-120235646 ACCCTACAATCAGAAGAGATTGG - Intergenic
997888064 5:137649259-137649281 AAATAAAAGACAGAAGTGATGGG + Intronic
998233879 5:140381100-140381122 AAACTACAAACAAATTAGATGGG - Intergenic
998344029 5:141445291-141445313 AACCTACAAACTGAAGAGAATGG - Intronic
998804634 5:145906466-145906488 AAATTAGAGACAGCAGAGAAAGG + Intergenic
998880637 5:146641409-146641431 AGCCTAAAGCCAGAAGAGATGGG - Intronic
999489014 5:152029888-152029910 AAATTACAAACAAAAGAAATTGG - Intergenic
999656748 5:153818053-153818075 AAGCTGCAGTCAGAAGAGTTCGG + Intergenic
1000192492 5:158924895-158924917 AAACTACAGAAAGGAAGGATGGG - Intronic
1000620873 5:163485198-163485220 AGACTACATTCAGATGAGATCGG + Intronic
1000916593 5:167089718-167089740 GAATTAAAGACAGAAGAGAATGG + Intergenic
1000936399 5:167307327-167307349 AAATCACAGACATCAGAGATGGG - Intronic
1001079147 5:168654199-168654221 AAGCTTCAGGGAGAAGAGATAGG - Intergenic
1003030839 6:2599160-2599182 GCACCACACACAGAAGAGATGGG - Intergenic
1004145306 6:13060500-13060522 AAATATGAGACAGAAGAGATAGG + Intronic
1004794926 6:19070808-19070830 AGAGAACAGACAGAAGAGAGTGG - Intergenic
1005154326 6:22786617-22786639 AAAGTACAGAAAGAAGAGAAGGG + Intergenic
1006250868 6:32782721-32782743 ACCCTACAAGCAGAAGAGATTGG + Intergenic
1007672943 6:43571421-43571443 AAATAACAGACATGAGAGATGGG - Intronic
1008120814 6:47615106-47615128 AAACTGCTGACAAAAGAAATAGG - Intronic
1008139907 6:47820421-47820443 AATCTACATACAGAATAAATCGG - Intronic
1009265185 6:61545290-61545312 AAAATACAAAAAGAAGTGATAGG + Intergenic
1009547921 6:65046052-65046074 AAACTTCAGACTCAAGAGGTGGG + Intronic
1009812815 6:68690693-68690715 AAACCTCAGCCATAAGAGATTGG + Intronic
1010034057 6:71301550-71301572 CAATTAGAGACAGAAGAGAAAGG + Exonic
1010326932 6:74575228-74575250 AAACTGCAGACTGAAGCAATAGG - Intergenic
1010439393 6:75875814-75875836 GAAAAACAGACTGAAGAGATAGG - Intronic
1011778966 6:90764978-90765000 AAACTGGGGACAGATGAGATTGG + Intergenic
1011863453 6:91790479-91790501 AAAGTACAGACAGAAGAGCATGG - Intergenic
1011869751 6:91878314-91878336 AAAATAGAGAAAGAAAAGATGGG + Intergenic
1011891365 6:92164828-92164850 AAACTACAAAGAGAATAAATAGG - Intergenic
1011928137 6:92673585-92673607 AACCCTAAGACAGAAGAGATTGG + Intergenic
1012198253 6:96372235-96372257 AAACTAGGAACAGAAGATATTGG + Intergenic
1012522493 6:100137635-100137657 AAAATACAGAAGGAAGAGTTTGG + Intergenic
1012824486 6:104129677-104129699 AAAATATAGACAAAAGAGACAGG + Intergenic
1012966625 6:105681802-105681824 ACACTGCAGAAAGAAAAGATTGG + Intergenic
1013950068 6:115769439-115769461 AAACTCCAGAAAAAAAAGATAGG + Intergenic
1014198288 6:118582827-118582849 AAACTACAGAAACAAGCTATAGG + Intronic
1014289497 6:119541360-119541382 AAACCACAGCCATAAAAGATCGG - Intergenic
1015046107 6:128778507-128778529 ACCCTACAGCCAGAAGAGAGTGG - Intergenic
1015580352 6:134717596-134717618 AAGCAACTGACAGAAAAGATAGG - Intergenic
1015879199 6:137854332-137854354 AAAATACACACAGAAGGGTTGGG + Intergenic
1016404373 6:143715036-143715058 AAAGTAGAGGCAGCAGAGATAGG - Intronic
1016406448 6:143736514-143736536 AAATTACAGACCAAAGAAATAGG - Intronic
1017098662 6:150827879-150827901 AATGTACAGACAGCAGAGACTGG + Intronic
1017247974 6:152248030-152248052 AAAATGCAGATAGAAGAAATGGG - Intronic
1017536938 6:155357328-155357350 AAACTACAGAAAGAAAACCTGGG + Intergenic
1017731863 6:157323939-157323961 AAAGTACAGACAGAAGACCTAGG - Intergenic
1019109130 6:169695827-169695849 AAGCTAGAGAGAGAAGAGTTGGG + Intronic
1020403025 7:7799211-7799233 AAACAACAAACAGAAAAGAATGG - Intronic
1020800748 7:12729212-12729234 AAACTGCAAACAGAAGATAGTGG - Intergenic
1020865033 7:13549408-13549430 AAACTACTGAAAGAAAACATTGG + Intergenic
1021214887 7:17903455-17903477 AAACTACAGACTTAGGAGTTAGG + Intronic
1022448596 7:30492724-30492746 AAACTACAGACTCAACAGATGGG - Intergenic
1022545651 7:31186292-31186314 AAAATGCAGACAGAAGGGCTGGG + Intergenic
1022592471 7:31678722-31678744 AAAGTATAAACAGAAAAGATAGG + Intergenic
1024162119 7:46687454-46687476 AAGCCACAGGCTGAAGAGATGGG + Intronic
1024952024 7:54873265-54873287 AAACAACACAGAGAAGGGATGGG + Intergenic
1026390319 7:69894723-69894745 AAAATAGAAACAAAAGAGATAGG - Intronic
1027506070 7:79018213-79018235 ACCCTACAAGCAGAAGAGATTGG + Intronic
1028022681 7:85796394-85796416 AAACTACTGAAAAAAAAGATTGG + Intergenic
1028083197 7:86602247-86602269 ATCCTAAAGCCAGAAGAGATTGG + Intergenic
1028173306 7:87625538-87625560 AAACTGCAGAAAGAAAAGAGTGG - Intronic
1029658269 7:101941898-101941920 AAACCACAGACACAAGGGAAAGG + Intronic
1029806599 7:103003870-103003892 AAAACTCAAACAGAAGAGATGGG - Intronic
1029843696 7:103391749-103391771 AAACAAAACACAAAAGAGATAGG + Intronic
1030790473 7:113721202-113721224 AAAGTACAATCAGAATAGATTGG + Intergenic
1031956993 7:127952860-127952882 AACCTACAGTCAGAAGAAAGGGG + Intronic
1032774744 7:135100321-135100343 AAACTGGAGAAAGAAGAGAATGG + Intronic
1032989154 7:137371968-137371990 AAACTAAATTCAGATGAGATGGG + Intergenic
1033715604 7:143998710-143998732 AAGCAACAGACAGAAAAGATTGG + Intergenic
1035965215 8:4184677-4184699 AAACAACAGACACCAGAGGTTGG + Intronic
1036598001 8:10231386-10231408 AAAACAGAGACAGAAGATATTGG + Intronic
1037714506 8:21385753-21385775 AAACATCAGTCAGAAGACATTGG + Intergenic
1037774551 8:21824526-21824548 AAACCACAGACAGAAGAGACAGG + Intergenic
1037870840 8:22494819-22494841 AAACCAGAAACTGAAGAGATTGG - Intronic
1037939556 8:22941434-22941456 CAGCCACAGACAGGAGAGATCGG + Intronic
1038394289 8:27235666-27235688 ACACTACAGAATTAAGAGATAGG + Exonic
1039115570 8:34088334-34088356 AAACTACAAACAGCAGCTATGGG + Intergenic
1041889877 8:62857168-62857190 ACTCTACAGCCAGAAGAGATTGG - Intronic
1041907034 8:63044802-63044824 ACCCTACAACCAGAAGAGATGGG + Intergenic
1042569512 8:70147297-70147319 AAACAAAAGACAGATGAGTTTGG - Intronic
1042637845 8:70898011-70898033 AAACTACTGAAAGAAAACATTGG - Intergenic
1043105363 8:76103205-76103227 AACCTACAGAAAGAAGAGGAAGG - Intergenic
1044224794 8:89706548-89706570 AAACTACAGATAGAAAATATTGG - Intergenic
1044576786 8:93778684-93778706 ACTCTACAGCCAGAAGAGAGTGG - Intronic
1044727594 8:95205879-95205901 AAACTACAGACACAAGAGAGAGG + Intergenic
1045081227 8:98628049-98628071 AAACTAGAGACAGGAGAATTAGG - Intronic
1046546830 8:115663320-115663342 AAAGAACAGACAGAAGTAATTGG - Intronic
1046936089 8:119887177-119887199 AAACTCCAGAAAGAAGGGAAGGG - Intronic
1046936190 8:119887503-119887525 CAACTCCAGAAAGAAGAGAAGGG - Intronic
1047890506 8:129303399-129303421 AAAATATAGAGAGAAGAGATTGG - Intergenic
1048166927 8:132070144-132070166 ACATTAAAGACAGGAGAGATTGG + Exonic
1048376803 8:133829853-133829875 AAAATACAGAGGGAAGATATGGG - Intergenic
1049528218 8:143140094-143140116 CAACAACAGAGAGAAGAAATGGG - Intergenic
1049796994 8:144501418-144501440 AAGGGACAGACAGGAGAGATGGG - Intronic
1050009031 9:1166388-1166410 AAACAACAGACACAATAGAATGG - Intergenic
1050365148 9:4867278-4867300 ACACAACAGAAAGCAGAGATGGG - Intronic
1050578214 9:7021754-7021776 AAACTACTAACAGAAAATATTGG - Intronic
1050610999 9:7353627-7353649 AAACTACAGAAAAAACTGATGGG + Intergenic
1051308991 9:15748634-15748656 ACCCTACAGCCAGAAGAGAGTGG + Intronic
1051495108 9:17712410-17712432 AAACTTCTGAAAGAAAAGATAGG - Intronic
1051495905 9:17722776-17722798 AAATTACTGACAGAAGAAAATGG - Intronic
1052080439 9:24199246-24199268 AAACTACTAAAAGAAGACATTGG - Intergenic
1052915572 9:33922488-33922510 AAACTAAACCCAGAAGAGAGGGG - Exonic
1054839078 9:69716225-69716247 AAACTACACAGAGAAGACATGGG - Intronic
1055390759 9:75820079-75820101 ACCCTACAGCCAGAAGAGAGTGG - Intergenic
1056998970 9:91489948-91489970 AACTTACAGACAAAAGCGATGGG + Intergenic
1057204891 9:93165468-93165490 AAACTCCAGAAATGAGAGATGGG + Intergenic
1058259993 9:102816187-102816209 ATCCTACAGCCAGAAGAGAGTGG + Intergenic
1058816028 9:108683546-108683568 AAACAAGAGACAGAAGAAAGTGG + Intergenic
1059564647 9:115371425-115371447 AAACAAGAAACAAAAGAGATTGG + Intronic
1059620846 9:116003808-116003830 AAACTGCAGACTCAAGAAATTGG - Intergenic
1059778921 9:117506442-117506464 ACCCTACAGCCAGAAGAGATTGG - Intergenic
1060296937 9:122349310-122349332 AAAATCCAGACACAAGAAATTGG - Intergenic
1060854317 9:126902788-126902810 AACCTCCAGACAGGAGAGAAGGG - Intergenic
1061956622 9:133966173-133966195 AAACTACTGAAAGAAAACATTGG + Intronic
1062706168 9:137944684-137944706 AAACAACATACAGAAAAGCTAGG - Intronic
1185504632 X:622273-622295 AAAAGACAGAGAGAAGAGAGAGG + Intergenic
1185597111 X:1314046-1314068 AAAAAACAGCCAGCAGAGATAGG + Intergenic
1185835100 X:3338136-3338158 GATCTTCAGACAGAGGAGATAGG + Intronic
1185940537 X:4314157-4314179 GAAACACAGACAGAAGAGAGAGG + Intergenic
1186370515 X:8942074-8942096 AAACTAGTGACAGCAGTGATTGG - Intergenic
1186796381 X:13050564-13050586 GCACTACAGACTGAAGAGACAGG + Intergenic
1187215694 X:17274263-17274285 AAACCAGAAACTGAAGAGATGGG - Intergenic
1188165738 X:26861019-26861041 AGCCTAGAGAGAGAAGAGATTGG + Intergenic
1188566863 X:31536466-31536488 AAACTGCAAACAGAATAGAGTGG + Intronic
1188593832 X:31872285-31872307 AAACTACACACAGCAGTGAGTGG + Intronic
1189135990 X:38550736-38550758 AAACTACTAAAAGAAGACATTGG - Intronic
1189920924 X:45902552-45902574 AAGTTTCAGACAGAAGAAATTGG + Intergenic
1190462898 X:50696277-50696299 AAATTAGAGCCAGAAGAGCTAGG + Intronic
1190532243 X:51391106-51391128 AAACTACTGAAAGAAAACATTGG + Intergenic
1190783076 X:53617269-53617291 ACACTACACACAGAAGAGATAGG + Intronic
1191703614 X:64069836-64069858 AAATGAAAGACATAAGAGATTGG - Intergenic
1193412844 X:81184726-81184748 AAACTACTGAAAGAAAACATTGG - Intronic
1193768354 X:85559747-85559769 ACTCTAAAGCCAGAAGAGATTGG - Intergenic
1193979766 X:88167959-88167981 ACTCTACAGTCAGAAGAGATTGG - Intergenic
1194183277 X:90739067-90739089 ACCCTACAACCAGAAGAGATTGG + Intergenic
1194194575 X:90876892-90876914 AAAATGCAGAAAGAACAGATGGG - Intergenic
1194380087 X:93180898-93180920 AAACTACTGACAAAAGGGATGGG + Intergenic
1194418856 X:93648157-93648179 AAACTACTGAAAGAAAACATTGG + Intergenic
1194533375 X:95077394-95077416 AAACTACAGAAGGAAGCTATAGG - Intergenic
1194925773 X:99821163-99821185 AAACTACTGAAAGAAAACATTGG + Intergenic
1195448143 X:104976970-104976992 AAAATAGAGTCAGAAGAGAAAGG + Intronic
1197081389 X:122421968-122421990 AAACTACAGATAATAGACATAGG + Intergenic
1197152692 X:123237380-123237402 AAATTCCAGACTGAAGAGTTTGG + Intronic
1198052758 X:132964384-132964406 ACACAACAGCCAGAAGAGAGTGG - Intergenic
1198171631 X:134111738-134111760 AAACTACAGGAAGAAAATATTGG - Intergenic
1199325827 X:146497026-146497048 AAACTACTGAAAGAAGACTTTGG + Intergenic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic
1200529893 Y:4321022-4321044 ACCCTACAACCAGAAGAGATTGG + Intergenic
1200730773 Y:6736322-6736344 AAACTACAGAGACAAGACAATGG - Intergenic
1200812479 Y:7500324-7500346 AAAGTGCAGACAGAAATGATTGG - Intergenic
1201973585 Y:19821594-19821616 ACCATACAGCCAGAAGAGATTGG + Intergenic