ID: 989469277 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:41796257-41796279 |
| Sequence | CTCTCTATTCAGGAGCTTCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 989469272_989469277 | -3 | Left | 989469272 | 5:41796237-41796259 | CCCATCTTGTGATCTATTTCCTC | 0: 1 1: 0 2: 1 3: 21 4: 259 |
||
| Right | 989469277 | 5:41796257-41796279 | CTCTCTATTCAGGAGCTTCAGGG | No data | ||||
| 989469273_989469277 | -4 | Left | 989469273 | 5:41796238-41796260 | CCATCTTGTGATCTATTTCCTCT | 0: 1 1: 1 2: 3 3: 35 4: 356 |
||
| Right | 989469277 | 5:41796257-41796279 | CTCTCTATTCAGGAGCTTCAGGG | No data | ||||
| 989469271_989469277 | 19 | Left | 989469271 | 5:41796215-41796237 | CCTGACTCATATCTAAGCTGCTC | 0: 1 1: 0 2: 1 3: 4 4: 105 |
||
| Right | 989469277 | 5:41796257-41796279 | CTCTCTATTCAGGAGCTTCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 989469277 | Original CRISPR | CTCTCTATTCAGGAGCTTCA GGG | Intronic | ||
| No off target data available for this crispr | |||||