ID: 989469277

View in Genome Browser
Species Human (GRCh38)
Location 5:41796257-41796279
Sequence CTCTCTATTCAGGAGCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989469272_989469277 -3 Left 989469272 5:41796237-41796259 CCCATCTTGTGATCTATTTCCTC 0: 1
1: 0
2: 1
3: 21
4: 259
Right 989469277 5:41796257-41796279 CTCTCTATTCAGGAGCTTCAGGG No data
989469273_989469277 -4 Left 989469273 5:41796238-41796260 CCATCTTGTGATCTATTTCCTCT 0: 1
1: 1
2: 3
3: 35
4: 356
Right 989469277 5:41796257-41796279 CTCTCTATTCAGGAGCTTCAGGG No data
989469271_989469277 19 Left 989469271 5:41796215-41796237 CCTGACTCATATCTAAGCTGCTC 0: 1
1: 0
2: 1
3: 4
4: 105
Right 989469277 5:41796257-41796279 CTCTCTATTCAGGAGCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989469277 Original CRISPR CTCTCTATTCAGGAGCTTCA GGG Intronic
No off target data available for this crispr