ID: 989470264

View in Genome Browser
Species Human (GRCh38)
Location 5:41808625-41808647
Sequence CTCTACCCAGTAGTTCAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989470264_989470271 7 Left 989470264 5:41808625-41808647 CCAAGTTGAACTACTGGGTAGAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 989470271 5:41808655-41808677 TGGGGATGAGTGAGGAGACAGGG 0: 1
1: 1
2: 4
3: 67
4: 625
989470264_989470270 6 Left 989470264 5:41808625-41808647 CCAAGTTGAACTACTGGGTAGAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 989470270 5:41808654-41808676 CTGGGGATGAGTGAGGAGACAGG 0: 1
1: 0
2: 4
3: 64
4: 529
989470264_989470274 16 Left 989470264 5:41808625-41808647 CCAAGTTGAACTACTGGGTAGAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 989470274 5:41808664-41808686 GTGAGGAGACAGGGAAAGTGGGG 0: 1
1: 2
2: 11
3: 111
4: 921
989470264_989470269 -1 Left 989470264 5:41808625-41808647 CCAAGTTGAACTACTGGGTAGAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 989470269 5:41808647-41808669 GAGGCATCTGGGGATGAGTGAGG 0: 1
1: 0
2: 2
3: 35
4: 414
989470264_989470272 14 Left 989470264 5:41808625-41808647 CCAAGTTGAACTACTGGGTAGAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 989470272 5:41808662-41808684 GAGTGAGGAGACAGGGAAAGTGG 0: 1
1: 1
2: 16
3: 191
4: 1293
989470264_989470273 15 Left 989470264 5:41808625-41808647 CCAAGTTGAACTACTGGGTAGAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 989470273 5:41808663-41808685 AGTGAGGAGACAGGGAAAGTGGG 0: 1
1: 0
2: 10
3: 86
4: 758

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989470264 Original CRISPR CTCTACCCAGTAGTTCAACT TGG (reversed) Intronic
901473415 1:9473145-9473167 CTCTGCCTAGTGCTTCAACTTGG - Intergenic
911743974 1:101418985-101419007 CTCTCACCATTAGTTCAAATTGG - Intergenic
915887610 1:159739994-159740016 TTCTCCCCAGTAGTTCAAAGTGG + Intergenic
916295460 1:163214291-163214313 CTCTCCCCAGAAATTCTACTAGG + Intronic
916440198 1:164817337-164817359 CTCTACCCAGCACTGCAAGTTGG - Intronic
921717670 1:218434926-218434948 CCATACCCAGTATTTCAAGTGGG + Intronic
922854260 1:228760662-228760684 TTCTAGCCATTAGTTGAACTTGG - Intergenic
922990252 1:229901393-229901415 ATCTAGTCAGTTGTTCAACTAGG - Intergenic
924189779 1:241538373-241538395 CTCTTTCAAGTAGTTTAACTTGG + Intronic
1075896116 10:125996127-125996149 CTCTACCCAGTAGGTGAGATGGG + Intronic
1080442768 11:32310752-32310774 CAATACCCAGTAGGTCATCTTGG + Intergenic
1086884176 11:92184170-92184192 ACCTAGTCAGTAGTTCAACTAGG - Intergenic
1103222672 12:119258911-119258933 CTCTCCCCAGCTGTGCAACTTGG + Intergenic
1103798153 12:123519464-123519486 GCCTTCCCAGCAGTTCAACTTGG - Intronic
1108238298 13:48432327-48432349 TTCTAAACAGTATTTCAACTTGG + Intronic
1109616261 13:64837477-64837499 CTGTACCCAGTAGAGCAACAGGG + Intergenic
1117665947 14:58056090-58056112 TTTTATCCAGAAGTTCAACTTGG + Intronic
1119456748 14:74762813-74762835 TTCTCCCCAGAAATTCAACTGGG - Intergenic
1120417491 14:84238407-84238429 CTCTACCCAATAATTTTACTGGG + Intergenic
1120503477 14:85325381-85325403 CTCTTCCCAGTAGTATAACAAGG - Intergenic
1123037339 14:105476890-105476912 CTCTACCTAGTAGGCCACCTGGG + Intronic
1125508335 15:40280086-40280108 ATCTACCCAGTAATAAAACTGGG + Intronic
1138700545 16:58858000-58858022 CTTTACCCAGTGATTCTACTGGG - Intergenic
1138946886 16:61862407-61862429 CCCAGCCCAGTAGTTCATCTTGG - Intronic
1144147809 17:12415073-12415095 GTCTCCCCAGTAGTTCTATTGGG + Intergenic
1145694978 17:26780470-26780492 CTGGACCCAGCAGTTCAGCTGGG - Intergenic
1146073396 17:29704961-29704983 GTCTACTCAGTATTTCCACTTGG + Intronic
1146144131 17:30396218-30396240 TTCTACCCTATATTTCAACTTGG - Intronic
1151848302 17:76673568-76673590 AGCTGCCCAGTAGATCAACTTGG + Exonic
1153071845 18:1115482-1115504 CACAACCCAGTAGCTCCACTGGG - Intergenic
1157400266 18:47381473-47381495 CTCTGCCCAGGAGTTCACCCAGG + Intergenic
931243422 2:60472451-60472473 CTAGACCCAGTATTTCCACTTGG + Intronic
933326615 2:80846004-80846026 CTCTACTCACTAAGTCAACTGGG + Intergenic
949060088 2:241951966-241951988 CTCTTCCCAGCAGTTCAAACAGG + Intergenic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1177709687 21:24756871-24756893 CTCTAACCAGTAACTAAACTGGG + Intergenic
1182857500 22:33530951-33530973 CTCTACCCAGTCATTCAATGTGG + Intronic
1185400680 22:50614067-50614089 ATCTACCCAATATTTCAATTAGG - Intergenic
951037371 3:17948669-17948691 CTCTACCTAGTCCTTCAGCTTGG - Intronic
954763545 3:52895170-52895192 CTCTTCCCAGTAGTTCAAGAAGG + Intronic
957233224 3:77548512-77548534 CACTACCTTGTAATTCAACTTGG - Intronic
966050238 3:175607633-175607655 AACTACCGAGTAGTTCAAATTGG + Intronic
966427496 3:179795149-179795171 CTTTAGCCAGTAGTACAAATTGG + Exonic
971071087 4:23092572-23092594 CTCTTCCCAGTTTGTCAACTGGG + Intergenic
972320664 4:37970819-37970841 CTCTACAAGGAAGTTCAACTGGG - Intronic
978199198 4:106005673-106005695 CTCTGCCCAGTAAAGCAACTAGG + Intergenic
979289736 4:118966363-118966385 CTCTACCCAGAAGCTAAAATGGG - Intronic
980917782 4:139050441-139050463 TTCTACCCAGTTGTTCCTCTAGG + Intronic
982480398 4:155902114-155902136 CTCTACATAGTTGTTCAACTGGG - Intronic
989470264 5:41808625-41808647 CTCTACCCAGTAGTTCAACTTGG - Intronic
991569723 5:68041412-68041434 CTCTGCCCAGTAGAGCATCTTGG + Intergenic
994297712 5:98110976-98110998 TTCTACCCTGTATTCCAACTGGG - Intergenic
996966794 5:129316089-129316111 CTCTACTCAGGAATTCAATTTGG + Intergenic
1019630625 7:2047036-2047058 TTCAACCCAGGAGTTCAACCCGG - Intronic
1021676566 7:23085951-23085973 CTCTCACCTGTAGTTTAACTTGG - Intergenic
1023278246 7:38543343-38543365 CTCTACCCAGGATTTCAAATGGG + Intronic
1023951862 7:44852575-44852597 CTCTACCCAGGAATTGGACTTGG + Intergenic
1026900508 7:74034292-74034314 CTCTACCCGGCAGCTCAGCTCGG + Intronic
1028128394 7:87141924-87141946 CTCCCACCAGTAGTTCAAATAGG - Intergenic
1028636040 7:92990139-92990161 CTCTTCCCAGCTGTTCCACTTGG - Intergenic
1029952704 7:104603911-104603933 CTCTACCCAGTAGCTCTCATAGG + Intronic
1039075392 8:33686349-33686371 CTCTACCAAGAAATTCAGCTGGG + Intergenic
1040724556 8:50367172-50367194 CTTTACCAAGTAGATCAGCTTGG + Intronic
1040756757 8:50784603-50784625 CTCTACCCATTAGTTACAGTGGG - Intronic
1052732152 9:32300551-32300573 CTTTACCCAGTCCTTCATCTAGG + Intergenic
1055638966 9:78304645-78304667 CTCTACCAAGTGCTTTAACTTGG - Intronic
1055781777 9:79828675-79828697 CTCTACCCAGTGGTGCACCCAGG + Intergenic
1056272514 9:84960212-84960234 CTCTTCCCAGTTGATAAACTGGG - Intronic
1060259904 9:122065250-122065272 CTCTACCCAGTTCTTAAAATTGG - Intronic
1061294825 9:129671380-129671402 CTCTGTCCAGTAGATCATCTGGG + Intronic
1186771703 X:12824964-12824986 CTGTCCCCTGTAGTTCAGCTAGG - Intergenic
1189359674 X:40340288-40340310 CTACACCCAGTATTTCACCTGGG + Intergenic
1192268712 X:69558183-69558205 CTCTACCTAAGACTTCAACTGGG - Intergenic
1202063422 Y:20912168-20912190 CTCTAACCTATAGTTTAACTAGG + Intergenic