ID: 989486387

View in Genome Browser
Species Human (GRCh38)
Location 5:41996388-41996410
Sequence AGTTATCTGCAAAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989486380_989486387 25 Left 989486380 5:41996340-41996362 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG No data
989486385_989486387 4 Left 989486385 5:41996361-41996383 CCAAGAGCTGTCACTCAAAAGGA No data
Right 989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG No data
989486383_989486387 15 Left 989486383 5:41996350-41996372 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG No data
989486381_989486387 22 Left 989486381 5:41996343-41996365 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG No data
989486382_989486387 16 Left 989486382 5:41996349-41996371 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989486387 Original CRISPR AGTTATCTGCAAAAGATGGC AGG Intergenic
No off target data available for this crispr