ID: 989487354

View in Genome Browser
Species Human (GRCh38)
Location 5:42007562-42007584
Sequence CTGGGTACTCAGATTAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989487354_989487360 12 Left 989487354 5:42007562-42007584 CCTTGATTAATCTGAGTACCCAG No data
Right 989487360 5:42007597-42007619 TCTCTGTAGCTTTCACAGGTTGG No data
989487354_989487359 8 Left 989487354 5:42007562-42007584 CCTTGATTAATCTGAGTACCCAG No data
Right 989487359 5:42007593-42007615 TTAATCTCTGTAGCTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989487354 Original CRISPR CTGGGTACTCAGATTAATCA AGG (reversed) Intergenic
No off target data available for this crispr