ID: 989487371

View in Genome Browser
Species Human (GRCh38)
Location 5:42007805-42007827
Sequence GGGATTAGTCTACTATATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989487371_989487378 7 Left 989487371 5:42007805-42007827 CCAACATATAGTAGACTAATCCC No data
Right 989487378 5:42007835-42007857 TCTAGAATTGGGTGGTAGTAGGG No data
989487371_989487377 6 Left 989487371 5:42007805-42007827 CCAACATATAGTAGACTAATCCC No data
Right 989487377 5:42007834-42007856 TTCTAGAATTGGGTGGTAGTAGG No data
989487371_989487372 -5 Left 989487371 5:42007805-42007827 CCAACATATAGTAGACTAATCCC No data
Right 989487372 5:42007823-42007845 ATCCCAATTATTTCTAGAATTGG No data
989487371_989487373 -4 Left 989487371 5:42007805-42007827 CCAACATATAGTAGACTAATCCC No data
Right 989487373 5:42007824-42007846 TCCCAATTATTTCTAGAATTGGG No data
989487371_989487376 -1 Left 989487371 5:42007805-42007827 CCAACATATAGTAGACTAATCCC No data
Right 989487376 5:42007827-42007849 CAATTATTTCTAGAATTGGGTGG No data
989487371_989487379 8 Left 989487371 5:42007805-42007827 CCAACATATAGTAGACTAATCCC No data
Right 989487379 5:42007836-42007858 CTAGAATTGGGTGGTAGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989487371 Original CRISPR GGGATTAGTCTACTATATGT TGG (reversed) Intergenic
No off target data available for this crispr