ID: 989489486

View in Genome Browser
Species Human (GRCh38)
Location 5:42033276-42033298
Sequence GGTGACTCCTAGTGTTGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989489486_989489488 -2 Left 989489486 5:42033276-42033298 CCAGTTCAACACTAGGAGTCACC No data
Right 989489488 5:42033297-42033319 CCTAAGAGTTGCAGTCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989489486 Original CRISPR GGTGACTCCTAGTGTTGAAC TGG (reversed) Intergenic
No off target data available for this crispr