ID: 989501963

View in Genome Browser
Species Human (GRCh38)
Location 5:42178059-42178081
Sequence TGAAATGCTAATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989501963_989501965 4 Left 989501963 5:42178059-42178081 CCCATATCACTATTAGCATTTCA No data
Right 989501965 5:42178086-42178108 AAACGATTCAACAAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989501963 Original CRISPR TGAAATGCTAATAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr