ID: 989512697

View in Genome Browser
Species Human (GRCh38)
Location 5:42306533-42306555
Sequence CAGACAAAGGAGAAGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989512691_989512697 17 Left 989512691 5:42306493-42306515 CCCCCAGGCAGAGATGCAGAGGA No data
Right 989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG No data
989512693_989512697 15 Left 989512693 5:42306495-42306517 CCCAGGCAGAGATGCAGAGGAAA No data
Right 989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG No data
989512689_989512697 24 Left 989512689 5:42306486-42306508 CCAATAACCCCCAGGCAGAGATG No data
Right 989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG No data
989512694_989512697 14 Left 989512694 5:42306496-42306518 CCAGGCAGAGATGCAGAGGAAAA No data
Right 989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG No data
989512692_989512697 16 Left 989512692 5:42306494-42306516 CCCCAGGCAGAGATGCAGAGGAA No data
Right 989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989512697 Original CRISPR CAGACAAAGGAGAAGTTGGA AGG Intergenic
No off target data available for this crispr