ID: 989516888

View in Genome Browser
Species Human (GRCh38)
Location 5:42354059-42354081
Sequence CAGTCAGGGCCTTCAGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989516888_989516891 5 Left 989516888 5:42354059-42354081 CCTGAAGCTGAAGGCCCTGACTG No data
Right 989516891 5:42354087-42354109 AGAAAAACTAACAAACAGAAAGG 0: 120
1: 5737
2: 2314
3: 680
4: 2012

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989516888 Original CRISPR CAGTCAGGGCCTTCAGCTTC AGG (reversed) Intergenic
No off target data available for this crispr