ID: 989518677

View in Genome Browser
Species Human (GRCh38)
Location 5:42375167-42375189
Sequence AGTTAGCGGCAGAAGAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989518672_989518677 6 Left 989518672 5:42375138-42375160 CCAAGTAATTTATACTGTGTCAC No data
Right 989518677 5:42375167-42375189 AGTTAGCGGCAGAAGAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989518677 Original CRISPR AGTTAGCGGCAGAAGAGGGT GGG Intergenic
No off target data available for this crispr