ID: 989522682

View in Genome Browser
Species Human (GRCh38)
Location 5:42420397-42420419
Sequence CTAACTTGAAGGCTTTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989522682_989522693 26 Left 989522682 5:42420397-42420419 CCAGCAAAAAGCCTTCAAGTTAG No data
Right 989522693 5:42420446-42420468 AGCAGGGAGGCCGGTGTGCTGGG No data
989522682_989522690 13 Left 989522682 5:42420397-42420419 CCAGCAAAAAGCCTTCAAGTTAG No data
Right 989522690 5:42420433-42420455 CTGCTTAAGAAACAGCAGGGAGG No data
989522682_989522687 9 Left 989522682 5:42420397-42420419 CCAGCAAAAAGCCTTCAAGTTAG No data
Right 989522687 5:42420429-42420451 TGGCCTGCTTAAGAAACAGCAGG No data
989522682_989522688 10 Left 989522682 5:42420397-42420419 CCAGCAAAAAGCCTTCAAGTTAG No data
Right 989522688 5:42420430-42420452 GGCCTGCTTAAGAAACAGCAGGG No data
989522682_989522691 17 Left 989522682 5:42420397-42420419 CCAGCAAAAAGCCTTCAAGTTAG No data
Right 989522691 5:42420437-42420459 TTAAGAAACAGCAGGGAGGCCGG No data
989522682_989522692 25 Left 989522682 5:42420397-42420419 CCAGCAAAAAGCCTTCAAGTTAG No data
Right 989522692 5:42420445-42420467 CAGCAGGGAGGCCGGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989522682 Original CRISPR CTAACTTGAAGGCTTTTTGC TGG (reversed) Intergenic
No off target data available for this crispr