ID: 989522689

View in Genome Browser
Species Human (GRCh38)
Location 5:42420432-42420454
Sequence CTCCCTGCTGTTTCTTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989522689_989522693 -9 Left 989522689 5:42420432-42420454 CCTGCTTAAGAAACAGCAGGGAG No data
Right 989522693 5:42420446-42420468 AGCAGGGAGGCCGGTGTGCTGGG No data
989522689_989522697 17 Left 989522689 5:42420432-42420454 CCTGCTTAAGAAACAGCAGGGAG No data
Right 989522697 5:42420472-42420494 AGAATGGATGACCCAGTGATGGG No data
989522689_989522698 18 Left 989522689 5:42420432-42420454 CCTGCTTAAGAAACAGCAGGGAG No data
Right 989522698 5:42420473-42420495 GAATGGATGACCCAGTGATGGGG No data
989522689_989522692 -10 Left 989522689 5:42420432-42420454 CCTGCTTAAGAAACAGCAGGGAG No data
Right 989522692 5:42420445-42420467 CAGCAGGGAGGCCGGTGTGCTGG No data
989522689_989522702 29 Left 989522689 5:42420432-42420454 CCTGCTTAAGAAACAGCAGGGAG No data
Right 989522702 5:42420484-42420506 CCAGTGATGGGGAAATTCATGGG No data
989522689_989522696 16 Left 989522689 5:42420432-42420454 CCTGCTTAAGAAACAGCAGGGAG No data
Right 989522696 5:42420471-42420493 CAGAATGGATGACCCAGTGATGG No data
989522689_989522695 1 Left 989522689 5:42420432-42420454 CCTGCTTAAGAAACAGCAGGGAG No data
Right 989522695 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
989522689_989522700 28 Left 989522689 5:42420432-42420454 CCTGCTTAAGAAACAGCAGGGAG No data
Right 989522700 5:42420483-42420505 CCCAGTGATGGGGAAATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989522689 Original CRISPR CTCCCTGCTGTTTCTTAAGC AGG (reversed) Intergenic
No off target data available for this crispr