ID: 989522690

View in Genome Browser
Species Human (GRCh38)
Location 5:42420433-42420455
Sequence CTGCTTAAGAAACAGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989522684_989522690 2 Left 989522684 5:42420408-42420430 CCTTCAAGTTAGGAGTCTGCCTG No data
Right 989522690 5:42420433-42420455 CTGCTTAAGAAACAGCAGGGAGG No data
989522682_989522690 13 Left 989522682 5:42420397-42420419 CCAGCAAAAAGCCTTCAAGTTAG No data
Right 989522690 5:42420433-42420455 CTGCTTAAGAAACAGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989522690 Original CRISPR CTGCTTAAGAAACAGCAGGG AGG Intergenic
No off target data available for this crispr