ID: 989522694

View in Genome Browser
Species Human (GRCh38)
Location 5:42420456-42420478
Sequence CCATTCTGCTCCCAGCACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989522694_989522707 26 Left 989522694 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
Right 989522707 5:42420505-42420527 GGAGATGAGGTGTGGGGCAAAGG No data
989522694_989522698 -6 Left 989522694 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
Right 989522698 5:42420473-42420495 GAATGGATGACCCAGTGATGGGG No data
989522694_989522697 -7 Left 989522694 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
Right 989522697 5:42420472-42420494 AGAATGGATGACCCAGTGATGGG No data
989522694_989522703 13 Left 989522694 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
Right 989522703 5:42420492-42420514 GGGGAAATTCATGGGAGATGAGG No data
989522694_989522696 -8 Left 989522694 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
Right 989522696 5:42420471-42420493 CAGAATGGATGACCCAGTGATGG No data
989522694_989522700 4 Left 989522694 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
Right 989522700 5:42420483-42420505 CCCAGTGATGGGGAAATTCATGG No data
989522694_989522706 20 Left 989522694 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
Right 989522706 5:42420499-42420521 TTCATGGGAGATGAGGTGTGGGG No data
989522694_989522705 19 Left 989522694 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
Right 989522705 5:42420498-42420520 ATTCATGGGAGATGAGGTGTGGG No data
989522694_989522702 5 Left 989522694 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
Right 989522702 5:42420484-42420506 CCAGTGATGGGGAAATTCATGGG No data
989522694_989522704 18 Left 989522694 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
Right 989522704 5:42420497-42420519 AATTCATGGGAGATGAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989522694 Original CRISPR CCATTCTGCTCCCAGCACAC CGG (reversed) Intergenic
No off target data available for this crispr